ID: 1028110741

View in Genome Browser
Species Human (GRCh38)
Location 7:86938100-86938122
Sequence TGGAGTTGATGCAACACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 132}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028110741 Original CRISPR TGGAGTTGATGCAACACTGC TGG Intronic
900482662 1:2906752-2906774 TGGCGTGGATCCACCACTGCGGG - Intergenic
904380744 1:30109096-30109118 TGAAGTTGAGGCTACAGTGCAGG - Intergenic
907194652 1:52676647-52676669 TGGAGCTGATGGAACCCAGCCGG + Intergenic
907569496 1:55469844-55469866 AGGACTTGATGCAAGACTCCTGG - Intergenic
909867258 1:80688364-80688386 GGGATTTGATGCACCTCTGCTGG - Intergenic
916483195 1:165233977-165233999 TGGAGTTGGGGTAACATTGCAGG - Intronic
916576889 1:166075227-166075249 AGGAGCTTCTGCAACACTGCAGG + Intronic
917929079 1:179811592-179811614 TGGATTTGGAGCCACACTGCCGG + Intronic
918378719 1:183933958-183933980 TGGATTGGAAGCAACACAGCTGG + Intronic
921997365 1:221435774-221435796 TGGAGTTGATGTAACTGTTCTGG - Intergenic
922352656 1:224746971-224746993 TGGGGTTGATGGAAGACTGAGGG + Intergenic
1064546863 10:16459386-16459408 TGGAGTAGCTACAGCACTGCTGG - Intronic
1068466283 10:57397075-57397097 TTGATTTTATGCTACACTGCAGG + Intergenic
1069526544 10:69177029-69177051 TTCAGATGATGCAACTCTGCTGG - Intergenic
1075474087 10:122718356-122718378 TGGAGTTGATATAAAACTACTGG - Intergenic
1076402501 10:130193172-130193194 TGGAGATGAGGCAGCTCTGCAGG - Intergenic
1079746818 11:24142822-24142844 TGGAGTTAAAGAACCACTGCAGG - Intergenic
1080420855 11:32109231-32109253 TGGACTTGATGTAAACCTGCAGG + Intergenic
1082288638 11:50343733-50343755 TGTAGTTGATGGATCACTGGAGG - Intergenic
1083017533 11:59470841-59470863 TGAAGCAAATGCAACACTGCTGG + Intergenic
1086890849 11:92256441-92256463 TAGAGTTGATAAAACACTGTGGG + Intergenic
1088811598 11:113396166-113396188 TGGACCTGATGAAACGCTGCTGG + Exonic
1093201148 12:16187637-16187659 TGGAGTAAATGGAACACTGCAGG + Intergenic
1093910216 12:24738852-24738874 TGGAATTCATGCTATACTGCAGG - Intergenic
1094860651 12:34462343-34462365 TGGAGTTGAGGCATTACTTCAGG - Intergenic
1096644204 12:53020310-53020332 AAGAGTTGAGGCAACACTGTGGG - Intronic
1098202122 12:68067651-68067673 TGGAGATGATGAAACACTCTTGG + Intergenic
1099534277 12:83826241-83826263 TGCAGTCTATGCAACACTTCAGG - Intergenic
1103967489 12:124649230-124649252 TGCTGTTCATGCAACTCTGCTGG + Intergenic
1106547350 13:30742339-30742361 TGGAGCTGATGAAATCCTGCAGG + Intronic
1112050471 13:95640394-95640416 TGGAGCTGATGCATGAATGCTGG - Intronic
1116594978 14:46829600-46829622 AGGAGTTGATCCAAGGCTGCTGG + Intergenic
1116710771 14:48365963-48365985 TGGAGTTGAAGCAACAATTCTGG + Intergenic
1117480122 14:56134662-56134684 TGTATTTGAAGCAAGACTGCTGG + Intronic
1118185327 14:63532380-63532402 TGCAGTAGATGCAACTCTCCAGG + Intronic
1125449557 15:39794248-39794270 TGCTGTTGGTGCCACACTGCTGG - Intergenic
1126645267 15:50869342-50869364 TGGAGTCAATGCAGAACTGCTGG + Intergenic
1128997949 15:72310490-72310512 TGGAAAGGAAGCAACACTGCAGG - Intronic
1129140319 15:73592054-73592076 TGGAGGTGAGGTTACACTGCAGG + Exonic
1130921261 15:88346789-88346811 TGGAGTTCAAGCAAGCCTGCTGG + Intergenic
1130949764 15:88576196-88576218 TGGAGTTCTTAGAACACTGCTGG - Intergenic
1132140110 15:99385236-99385258 TAGAGTTGAGGCAACTTTGCTGG + Intronic
1132175334 15:99709549-99709571 CGGAGTTGAAGCGACACAGCTGG - Intronic
1136485841 16:30571322-30571344 TGGTGTTGGTGCAAGAGTGCGGG + Intronic
1137343827 16:47636592-47636614 GGGTGCTGATGCAACACAGCTGG + Intronic
1137870507 16:51945825-51945847 TGGAGTTAATGCAACCCCGAAGG + Intergenic
1138550410 16:57744637-57744659 TGGAGTGGGTGCCACACTGCCGG - Intronic
1139057811 16:63207482-63207504 TGGAGTTGATGAAACACTGAAGG + Intergenic
1144789978 17:17852267-17852289 TGGAGTTGTCACATCACTGCTGG - Intronic
1149282282 17:55120869-55120891 TTGAGCTGATGCAACTCTGAGGG - Intronic
1150205280 17:63400151-63400173 TGGAGATGTGGCAACACTGTTGG - Intronic
1150464249 17:65378334-65378356 TTAAGTTGATGCACCACTGAAGG + Intergenic
1150525605 17:65919275-65919297 CTGAGTGGATGCAACACTCCAGG + Intronic
1153825928 18:8874980-8875002 TGGATTTGATGCAGCCTTGCTGG - Intergenic
1155614132 18:27701753-27701775 TGGAGTTGATCTAGCACTGGTGG + Intergenic
1158419223 18:57278207-57278229 TGGAGTTGATCCTACACTCCAGG + Intergenic
1160562029 18:79764848-79764870 TGGGGTTGGGGCTACACTGCTGG - Intergenic
1165365613 19:35363101-35363123 TGGAGCTGATGCGGCACTGGAGG - Intergenic
1165435430 19:35792416-35792438 TGGAGTTGTTGCAGCTCTGCCGG - Intergenic
926975880 2:18516324-18516346 TGGAGTCGATTTAACCCTGCAGG + Intergenic
929054997 2:37868999-37869021 AGGATTTGAAGCCACACTGCTGG - Intergenic
930215137 2:48688469-48688491 GGGAGTGGGTGCAGCACTGCTGG - Exonic
931251842 2:60538353-60538375 TGGATCTGATGCAATGCTGCTGG - Intronic
932556300 2:72827403-72827425 TGGAGATAAGGCAACACTGTAGG + Intergenic
932595937 2:73093514-73093536 TGGAGCTGTTACAACCCTGCAGG + Intronic
939419139 2:141943576-141943598 AGGAGTTAATGCAACACTGAAGG - Intronic
940295004 2:152113444-152113466 TGGGTTTGATGCATCACAGCTGG + Intergenic
942741073 2:179178655-179178677 TGGAGTAGTGGCAACAATGCAGG + Intronic
945033403 2:205685192-205685214 TGGAAGTGACGCAGCACTGCTGG - Intronic
1169376928 20:5073642-5073664 GGGAGTTGATGCAACAAAGTGGG + Intronic
1175694407 20:61090688-61090710 TCGAGTTAAAGCAACACTGCAGG - Intergenic
1179457109 21:41507598-41507620 AGGAGTTCAGGTAACACTGCGGG + Intronic
1182600115 22:31455877-31455899 TGGTGTTGACCCAAGACTGCTGG + Exonic
1183805096 22:40202621-40202643 AGGTGTTGATCCAACACTGTGGG - Intronic
950074239 3:10175933-10175955 TGTAGTTGTTGCCACGCTGCAGG - Intronic
951969072 3:28422841-28422863 GGGAGGTGAAGCAACACTGTTGG - Intronic
951982435 3:28580512-28580534 TGCAGTTGATGCAGAACTTCAGG - Intergenic
956450660 3:69371524-69371546 TGGGGTTGAGAAAACACTGCAGG + Intronic
959873344 3:111353249-111353271 AGGAATTGAGGCAACACTACAGG + Intronic
962132804 3:132700044-132700066 TGTAGTTGATGCAGCACTCTTGG - Exonic
962282587 3:134063461-134063483 TGGAGTTGATGCAGGAATGCAGG - Intergenic
964091594 3:152883595-152883617 TGCTATTGATGCCACACTGCAGG + Intergenic
967118528 3:186362526-186362548 TGGAGAGGATGCAACAGTGGTGG + Intergenic
969332139 4:6480597-6480619 TGGATTTCAAACAACACTGCAGG + Intronic
972075227 4:35079109-35079131 GTGACTTGATGCAAGACTGCAGG + Intergenic
980004538 4:127526860-127526882 TGGAGCTCATGAAACACTTCTGG - Intergenic
980404011 4:132332532-132332554 AGGATTTGAAGCAACACTGCAGG + Intergenic
981160520 4:141493030-141493052 TGGAATTGATGCATTATTGCAGG + Intergenic
982150353 4:152448139-152448161 TGGAGTTTATGTGAGACTGCCGG - Intronic
983352707 4:166613542-166613564 TGGAGTAGCTGCAACAGAGCTGG + Intergenic
983936491 4:173506396-173506418 AGGAGTTGATGGCACACTGAGGG - Intergenic
984068895 4:175086706-175086728 TGGAGCTGATGCAAGACAGGTGG - Intergenic
986539513 5:8828965-8828987 TGGGGTGAATGCAACACTCCAGG - Intergenic
987104574 5:14625101-14625123 TGGAGTTGCTGCTTCCCTGCTGG - Intergenic
990941909 5:61210947-61210969 TGGAGTAGATGAAACCCTGTTGG + Intergenic
992069305 5:73135210-73135232 TGGAATTTAGGAAACACTGCAGG - Intergenic
992168492 5:74078237-74078259 TGGGGTAGATGCAACAATGAGGG - Intergenic
997236408 5:132274651-132274673 TGTAGTTGCTGCAACCCTGAAGG - Intronic
998300068 5:141009562-141009584 TGCTCTTGATGCCACACTGCTGG - Intronic
1000164680 5:158636659-158636681 TGCACTTGCTGCAACACAGCTGG - Intergenic
1003166004 6:3679145-3679167 TGGACTTGATGCAACAAGACTGG + Intergenic
1005978465 6:30817875-30817897 GGGAGTTGATCCATCACTTCTGG - Intergenic
1006868633 6:37230124-37230146 AGGACTTGATGTACCACTGCTGG - Intronic
1009480375 6:64150187-64150209 TGGAGATGTTGTAAAACTGCAGG - Intronic
1013169121 6:107620230-107620252 TGGAGTAGAAGCCAAACTGCAGG - Intronic
1014296733 6:119627596-119627618 TGGAAATGCTGCAAGACTGCAGG - Intergenic
1020451324 7:8323462-8323484 TGGAGGTGGGGCAAAACTGCAGG + Intergenic
1021224958 7:18015576-18015598 TGAAGCTGATGCAATACTGCAGG + Intergenic
1021847267 7:24775076-24775098 TTAATTTGATGAAACACTGCGGG - Intergenic
1024763701 7:52630652-52630674 TGTTGTTGTTGTAACACTGCTGG - Intergenic
1028110741 7:86938100-86938122 TGGAGTTGATGCAACACTGCTGG + Intronic
1028715262 7:93958346-93958368 TGGAGTTGATGGAAAATTCCAGG + Intergenic
1030626026 7:111847084-111847106 TGGAGGTGATGTAACACGACAGG + Exonic
1030950815 7:115789151-115789173 TTGAGTTCATGAAGCACTGCAGG + Intergenic
1035473418 7:159126008-159126030 TGAAGCTGATGAAACAATGCAGG + Intronic
1036165263 8:6426726-6426748 TGGAGTGAAAGGAACACTGCTGG - Intronic
1037351731 8:17966380-17966402 TTGAGGAGATGCAACATTGCTGG - Exonic
1040574796 8:48642202-48642224 TGGAATTGACACCACACTGCAGG + Intergenic
1046457305 8:114483801-114483823 AGGAGTTGAGGCAGCCCTGCAGG + Intergenic
1047241946 8:123098862-123098884 TGCAGTTGATGCAACTCCTCTGG - Intronic
1047769622 8:128020430-128020452 AGGAGTTGATGTGCCACTGCTGG + Intergenic
1050030513 9:1380782-1380804 TGGAGTTTATAGAAAACTGCGGG + Intergenic
1050694122 9:8260286-8260308 TGGAGTTGAAGCCACACCTCAGG - Intergenic
1053606671 9:39666945-39666967 TGGAGAAGATGCCAAACTGCAGG + Intergenic
1054246864 9:62675459-62675481 TGGAGAAGATGCCAAACTGCAGG - Intergenic
1054560985 9:66709993-66710015 TGGAGAAGATGCCAAACTGCAGG - Intergenic
1055438632 9:76317629-76317651 TGGAGTTGGTGCAAAGTTGCAGG - Intronic
1057366767 9:94429764-94429786 TGGAGTAAATGCAGCACCGCTGG - Intronic
1057656568 9:96958300-96958322 TGGAGTAAATGCAGCACCGCTGG + Intronic
1057699211 9:97350534-97350556 TTGAGTTCATCAAACACTGCAGG + Exonic
1058012818 9:99997261-99997283 TGGTGATCAGGCAACACTGCTGG - Intronic
1058862742 9:109132425-109132447 TGGAATTGATGCAAAAGTGGTGG - Exonic
1186212244 X:7261587-7261609 TGGAGTTGATGCTTTACTGGAGG + Intronic
1186419855 X:9416849-9416871 TTGAGTTGATGAAACACTAGAGG + Intergenic
1187228389 X:17396875-17396897 TAGACATGATGCAACATTGCTGG - Intronic
1191140893 X:57115578-57115600 TGGAGTTTAGGTAACACTGGCGG + Intergenic
1193162159 X:78240472-78240494 TGGAGATGTGGCACCACTGCTGG - Intergenic
1194268948 X:91785488-91785510 TGGAATTGATTCAACATCGCTGG + Intronic
1195375525 X:104223661-104223683 TGGGGTTGGTTCACCACTGCTGG + Intergenic
1198479697 X:137030321-137030343 AGGGGTGGATGCAGCACTGCAGG + Exonic
1198701821 X:139405274-139405296 TGGACTTGCTGCACCCCTGCAGG + Intergenic
1200586163 Y:5006500-5006522 TGGAATTGATTCAACATCGCTGG + Intronic
1201465607 Y:14277162-14277184 TGCAGTTAATGTAAAACTGCTGG + Intergenic
1201585289 Y:15553489-15553511 TGGAGTTGATGCTTTACTGGAGG + Intergenic