ID: 1028112013

View in Genome Browser
Species Human (GRCh38)
Location 7:86951947-86951969
Sequence ACATTGGCACTATACTTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028112007_1028112013 6 Left 1028112007 7:86951918-86951940 CCCTCTTGTACTTAGGAACACTA 0: 5
1: 39
2: 114
3: 177
4: 334
Right 1028112013 7:86951947-86951969 ACATTGGCACTATACTTGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 66
1028112008_1028112013 5 Left 1028112008 7:86951919-86951941 CCTCTTGTACTTAGGAACACTAG 0: 2
1: 4
2: 13
3: 14
4: 100
Right 1028112013 7:86951947-86951969 ACATTGGCACTATACTTGGAGGG 0: 1
1: 0
2: 0
3: 5
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028112013 Original CRISPR ACATTGGCACTATACTTGGA GGG Intronic
904880254 1:33691015-33691037 ACATTTGCACTTGACTTTGAGGG + Intronic
906012717 1:42543995-42544017 ACCTTAGCACAATACTTTGATGG + Intronic
922943169 1:229486408-229486430 ATATTGGCAGAAGACTTGGAAGG - Exonic
1066675553 10:37883470-37883492 ACTTTTGCACTGTACTTGGTTGG - Intergenic
1071325739 10:84515242-84515264 ACATTTGCACAAAACTTTGATGG + Exonic
1078537765 11:12188639-12188661 ACAATGACACTAAAATTGGAGGG + Intronic
1090121784 11:124037982-124038004 ACATAAGCATTATACTTGAATGG - Intergenic
1097553578 12:61107881-61107903 ACAATGGAACCATGCTTGGAGGG + Intergenic
1101748852 12:107565908-107565930 ACATTGGTACTATATAGGGAAGG - Intronic
1102535206 12:113575997-113576019 ACATTTGCACCAAACCTGGATGG + Intergenic
1103302549 12:119939076-119939098 ATATTGGCACAAATCTTGGACGG + Intergenic
1109723516 13:66308500-66308522 ACAATGGCACTCTACATGAAAGG + Intronic
1110043373 13:70795549-70795571 ACATTGGCATCATGCTTGGATGG + Intergenic
1115481417 14:33865241-33865263 AAATTGGCACTATATGTGAAGGG + Intergenic
1120456718 14:84739969-84739991 AAATTGGAACAATACTGGGAAGG + Intergenic
1129031247 15:72619501-72619523 TCAGTGGCACTATCCTTGGTAGG + Intergenic
1129218688 15:74117955-74117977 TCAGTGGCACTATCCTTGGTAGG - Intronic
1129395950 15:75246454-75246476 TCAGTGGCACTATCCTTGGTAGG + Intergenic
1129405663 15:75315599-75315621 TCAGTGGCACTATCCTTGGTAGG + Intergenic
1137066387 16:35849841-35849863 ACTTTTGCTCTATACTTGGTGGG + Intergenic
1137542315 16:49373182-49373204 TCAATGGTACTAGACTTGGATGG - Intergenic
1137933920 16:52615294-52615316 ACATTGGTACAATATTTGGAGGG + Intergenic
1148210580 17:45806210-45806232 GCATAGGCCCTATACCTGGAGGG - Intronic
1148964964 17:51427459-51427481 AGATTGTCACTATTTTTGGAGGG - Intergenic
1150747778 17:67830098-67830120 ACATTGCCAATATACTGAGAAGG + Intronic
1156200080 18:34820929-34820951 AAATTGTCTCTATACTGGGAGGG - Intronic
1156265303 18:35482643-35482665 ACATTTGCACTGAGCTTGGAGGG - Intronic
1159853636 18:73557690-73557712 ACATTTGCAAAATACTTGGAAGG - Intergenic
1160382097 18:78467757-78467779 ACAGTGGCTCTGTACCTGGAGGG + Intergenic
1165556417 19:36636427-36636449 GCACTGCCACTATTCTTGGAAGG + Intergenic
1168647070 19:58066370-58066392 ACAGAGGCACTGGACTTGGAAGG - Intronic
926632835 2:15152801-15152823 AGATTGGCTCCCTACTTGGAGGG - Intergenic
926988628 2:18652065-18652087 ACATTAGAATTATACTTGCAAGG - Intergenic
931943801 2:67282878-67282900 ACATTGGCATTATTCCAGGAAGG + Intergenic
934046615 2:88178042-88178064 CCATTGGATCTACACTTGGAAGG - Intronic
938592306 2:132751361-132751383 ACACTGGCACCATGCTTGTACGG + Intronic
940161079 2:150714185-150714207 ATATTGGGATTATACTAGGAAGG - Intergenic
941325328 2:164107284-164107306 ACTTTGGCGATATACTTGCATGG + Intergenic
1171251933 20:23655562-23655584 CCATTGCCACTTCACTTGGATGG + Intergenic
1174526809 20:51178715-51178737 ACATTGTTTCTTTACTTGGAAGG - Intergenic
1181266775 22:21635222-21635244 ACCTGGGCACTAGACATGGAGGG - Exonic
1184182990 22:42843562-42843584 ACATTTGCAATGAACTTGGAAGG - Intronic
950912875 3:16613441-16613463 ACATTGGCACAACACTTTAAAGG - Intronic
967233234 3:187360670-187360692 ATATTGGCATTATAATTGGCAGG + Intergenic
976349842 4:84048904-84048926 ACATTCTCAATCTACTTGGAAGG + Intergenic
976570729 4:86606554-86606576 AAATTAGCATTATACTTGGCAGG + Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979613312 4:122712675-122712697 AAATTGGCACTATATGTGAAAGG - Intergenic
982400478 4:154961838-154961860 TCATTGGTACTATGCTTAGATGG + Intergenic
983754457 4:171317574-171317596 ACATCAGTACTATACTTGCAAGG - Intergenic
986024135 5:3834376-3834398 ACATTAGTACTGTACTTGTAAGG + Intergenic
987763932 5:22200973-22200995 ACATTTGCACTCCACTTGTAGGG + Intronic
990291850 5:54360059-54360081 AACTTGGAACTATACTGGGAAGG + Intergenic
994192940 5:96888617-96888639 AAAGTAGCTCTATACTTGGAAGG + Intronic
998029791 5:138856301-138856323 ACATTGTCACTACACTGTGATGG + Intronic
999603251 5:153290116-153290138 AAAATGGCACTATACTGGGAGGG + Intergenic
1003709224 6:8570277-8570299 ACATTAGCACTCTTTTTGGAAGG - Intergenic
1006735087 6:36267788-36267810 ACATGGGCACTATCCATGGGGGG - Intronic
1013926112 6:115474756-115474778 ACATTTGCATTATAAATGGAAGG - Intergenic
1014658928 6:124142143-124142165 ACATTGGGATTCTACTTGGGAGG + Intronic
1028112013 7:86951947-86951969 ACATTGGCACTATACTTGGAGGG + Intronic
1030861912 7:114642476-114642498 ACAATGGCATTAAACATGGAGGG + Exonic
1042880362 8:73481316-73481338 ACATTGCCATTATAGATGGAGGG + Intronic
1046685178 8:117217195-117217217 AAATTGGCACAAGACTTGAATGG - Intergenic
1046834206 8:118781419-118781441 TCAGTGGCACTGTACTTGGAAGG + Intergenic
1047127132 8:121975043-121975065 TCATTGTCACTAAACTTGCAGGG + Intergenic
1061465027 9:130771339-130771361 AAACTGGCACTCTACTTAGAAGG - Intronic
1186133495 X:6494869-6494891 ACATTGGCCATATACCTCGATGG + Intergenic
1187484706 X:19692429-19692451 ACATTGGCATTATATTTATAAGG - Intronic
1191707270 X:64106232-64106254 GAATTGGGACTATACATGGAAGG + Intergenic
1192911729 X:75611915-75611937 ATATAGGCCCTATACTTGTAAGG - Intergenic
1201558350 Y:15288502-15288524 ACTTTGACACTACACTTGGGAGG - Intergenic