ID: 1028112139

View in Genome Browser
Species Human (GRCh38)
Location 7:86953486-86953508
Sequence CTATGTCAACACTGCTACCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028112132_1028112139 28 Left 1028112132 7:86953435-86953457 CCAAAACTACCTGCTTTTCCTTT 0: 1
1: 0
2: 1
3: 32
4: 462
Right 1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG No data
1028112136_1028112139 -5 Left 1028112136 7:86953468-86953490 CCTAGCCTCATCCACTCTCTATG 0: 1
1: 0
2: 1
3: 24
4: 227
Right 1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG No data
1028112134_1028112139 10 Left 1028112134 7:86953453-86953475 CCTTTTATCTTCCATCCTAGCCT 0: 1
1: 0
2: 2
3: 23
4: 314
Right 1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG No data
1028112135_1028112139 -1 Left 1028112135 7:86953464-86953486 CCATCCTAGCCTCATCCACTCTC 0: 1
1: 0
2: 3
3: 25
4: 481
Right 1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG No data
1028112133_1028112139 19 Left 1028112133 7:86953444-86953466 CCTGCTTTTCCTTTTATCTTCCA 0: 1
1: 1
2: 7
3: 74
4: 866
Right 1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG No data
1028112137_1028112139 -10 Left 1028112137 7:86953473-86953495 CCTCATCCACTCTCTATGTCAAC 0: 1
1: 0
2: 0
3: 12
4: 152
Right 1028112139 7:86953486-86953508 CTATGTCAACACTGCTACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028112139 Original CRISPR CTATGTCAACACTGCTACCT TGG Intronic
No off target data available for this crispr