ID: 1028112420

View in Genome Browser
Species Human (GRCh38)
Location 7:86958006-86958028
Sequence TGTGATGCAAATTAATATCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 145}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028112420_1028112423 3 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112423 7:86958032-86958054 CTATCAAGAGGTAAATGTTAGGG 0: 1
1: 0
2: 1
3: 18
4: 191
1028112420_1028112428 27 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112428 7:86958056-86958078 TGTGCAGATGCCTCAGGATGGGG No data
1028112420_1028112425 21 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112425 7:86958050-86958072 TAGGGGTGTGCAGATGCCTCAGG 0: 1
1: 0
2: 1
3: 7
4: 156
1028112420_1028112426 25 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112426 7:86958054-86958076 GGTGTGCAGATGCCTCAGGATGG 0: 1
1: 0
2: 2
3: 24
4: 305
1028112420_1028112422 2 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112422 7:86958031-86958053 TCTATCAAGAGGTAAATGTTAGG No data
1028112420_1028112424 4 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112424 7:86958033-86958055 TATCAAGAGGTAAATGTTAGGGG 0: 1
1: 0
2: 0
3: 7
4: 198
1028112420_1028112421 -9 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112421 7:86958020-86958042 TGCATCACATTTCTATCAAGAGG 0: 1
1: 0
2: 0
3: 12
4: 120
1028112420_1028112427 26 Left 1028112420 7:86958006-86958028 CCAGGATATTAATTTGCATCACA 0: 1
1: 0
2: 1
3: 12
4: 145
Right 1028112427 7:86958055-86958077 GTGTGCAGATGCCTCAGGATGGG 0: 1
1: 0
2: 0
3: 22
4: 269

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028112420 Original CRISPR TGTGATGCAAATTAATATCC TGG (reversed) Intronic
903024909 1:20420973-20420995 TCTGATGGAAAATAATTTCCAGG + Intergenic
907853346 1:58277918-58277940 TGTGAAGCAGATTACAATCCAGG - Intronic
910890213 1:92010685-92010707 TGGGATGAAAATTAATACACTGG - Intronic
911507632 1:98773280-98773302 TGTCAAGCAAATTAATATCTAGG - Intergenic
912659181 1:111513382-111513404 TGTAATGCAAATTAAATTACTGG - Intronic
912705822 1:111911221-111911243 TGTAATGCAAATTTACTTCCTGG + Intronic
914328502 1:146644340-146644362 TGTGATCCCAAATAAAATCCTGG + Intergenic
916224537 1:162476152-162476174 TGTGATGCTTATTAATATCTGGG - Intergenic
917430327 1:174960846-174960868 AGTGATGCCCATTAATTTCCAGG + Intronic
920939434 1:210467605-210467627 GGTGATGCAAATTATTCTGCTGG + Intronic
921867825 1:220105105-220105127 TGTGAAGTAAATTATTATCTTGG - Intronic
922062923 1:222108719-222108741 TGTGATTCTAATGAATATCTAGG - Intergenic
922139361 1:222866692-222866714 GATGAAGCAAATTAAAATCCAGG + Intergenic
1063876644 10:10485429-10485451 TGAGATGAAAAGCAATATCCTGG - Intergenic
1064324989 10:14341254-14341276 TGTTATACAAATTACAATCCAGG + Intronic
1065852909 10:29805586-29805608 TCTGATGAAATTTAATATCAAGG - Intergenic
1066025249 10:31350705-31350727 TGTGATGAAAGTTATTATCTGGG + Intronic
1066233768 10:33465451-33465473 TCTGCTGCAAATTAATTGCCTGG + Intergenic
1068400725 10:56524482-56524504 TATGTTGCAAATTAATTTACAGG - Intergenic
1068824921 10:61425711-61425733 AGAGCTGCAAATTAATGTCCTGG + Intronic
1069541872 10:69300796-69300818 AGTGGTGCACATTAATGTCCTGG - Intronic
1072765683 10:98093523-98093545 AGTGATTCAATTTAATATTCTGG - Intergenic
1075545919 10:123354578-123354600 ACTGGTGCAAATTAATATTCTGG + Intergenic
1080236605 11:30076031-30076053 GGTGAACGAAATTAATATCCTGG - Intergenic
1085911072 11:80827525-80827547 CGTGATGCAAATTAAAAAGCAGG + Intergenic
1086283327 11:85216626-85216648 TGTGATTCACATTTATATTCAGG - Intronic
1086447786 11:86886553-86886575 TAAGATGCAGATTAATATGCAGG - Intronic
1086515771 11:87611567-87611589 TGTTTTGCTAATTAATATTCTGG + Intergenic
1088190304 11:107221168-107221190 AGTGAACTAAATTAATATCCTGG + Intergenic
1088231082 11:107673927-107673949 TGTGATACAAAATTATAGCCAGG + Intergenic
1092674352 12:10899958-10899980 TGTGATGAAAATAAACATTCAGG - Intronic
1093269194 12:17037880-17037902 TGTGATAAAAATTAATATATGGG - Intergenic
1093826310 12:23694245-23694267 TGTGAAGCAAAGTATTATCAAGG - Intronic
1099178454 12:79450910-79450932 TGTGATCCATTTTAATTTCCAGG + Exonic
1101236348 12:102793990-102794012 TGCTATGCAAATGAATAACCGGG - Intergenic
1105553221 13:21418172-21418194 TGTGATGCATATTAGTAAACAGG + Intronic
1106627738 13:31438049-31438071 TGTGATTCAAATTGATAGCAGGG - Intergenic
1106949218 13:34864172-34864194 TGTGATAGATATTATTATCCTGG - Intergenic
1107407056 13:40124486-40124508 TGTAATTCAAATTTATATACTGG + Intergenic
1107636605 13:42398540-42398562 TGTTATGCTAACTGATATCCAGG + Intergenic
1107739073 13:43429736-43429758 TGTGATGCAAAATAAAATGGAGG + Intronic
1108031364 13:46233062-46233084 TATGATGTAAATTAACTTCCGGG + Intronic
1109687199 13:65836322-65836344 TGTGATGCTAACTAAAATCAAGG + Intergenic
1110494836 13:76155508-76155530 TGTGATGCAAATTAGTTTGAAGG + Intergenic
1110534611 13:76636797-76636819 TGTCATGCAAATTAAAATAGAGG + Intergenic
1113503590 13:110797679-110797701 TGTAATGCAAATGAATAAACTGG + Intergenic
1115447604 14:33509457-33509479 TGAGATTAAAATTAAGATCCAGG - Intronic
1116090791 14:40303275-40303297 TGTAATGAAAATTTATATCTTGG - Intergenic
1116788459 14:49313839-49313861 TGTGATGGCAAATAAAATCCAGG - Intergenic
1117217571 14:53567811-53567833 AGTGATGCACATTGATATGCTGG + Intergenic
1118902647 14:69999566-69999588 AGTTATGGAAATAAATATCCAGG - Intronic
1124783501 15:32658134-32658156 TGTGATACAAACTGATATCCAGG + Intronic
1125257500 15:37782167-37782189 TGTGATTTAAAATAATATCTTGG + Intergenic
1128615763 15:69108115-69108137 TGTTATGCAAAATAATTTACTGG + Intergenic
1131706488 15:95001689-95001711 TGAGATGCAAATTCATTGCCTGG - Intergenic
1137881340 16:52051673-52051695 TGGGGAGAAAATTAATATCCAGG + Intronic
1140005062 16:71066602-71066624 TGTGATCCCAAATAAAATCCTGG - Intronic
1142844255 17:2659926-2659948 TGTGATTAAAATTTATTTCCAGG - Intronic
1147949285 17:44098026-44098048 GGTCCTGCAAATTAATATTCTGG - Intronic
1149727812 17:58914346-58914368 CGTGATGCAATGTAGTATCCTGG - Intronic
1150370651 17:64634797-64634819 TCTGATGCTAATACATATCCTGG + Intronic
1150728961 17:67675170-67675192 AGTGATACAAATAAATATCTAGG - Intronic
1155550412 18:26959192-26959214 TCCTAAGCAAATTAATATCCAGG + Intronic
1157251498 18:46099803-46099825 GGTGAGGCAAATAAATATCCGGG + Intronic
1160146512 18:76370009-76370031 TGTGATGCACCTTACCATCCAGG - Intronic
1161369955 19:3905567-3905589 TGTCATCCACGTTAATATCCAGG - Exonic
1162048589 19:8018121-8018143 TCTGATGCAAAATAAAAACCTGG - Intronic
928289933 2:30028121-30028143 TGAGTTGCAAAATAAAATCCCGG - Intergenic
928304434 2:30155191-30155213 TGTGATGCTTGTTAATATGCTGG + Intronic
931352514 2:61504255-61504277 CATGATGCAAATTAAAATCAAGG - Intronic
933416550 2:81993942-81993964 TGAGAAGCAACTTAATCTCCTGG + Intergenic
935391458 2:102557676-102557698 TGTCATGTAATTTAATATCTTGG + Intergenic
938085376 2:128396453-128396475 TGTTAAGCAAATTAACAACCTGG - Intergenic
939244984 2:139611649-139611671 TTTGTTGCACATAAATATCCAGG + Intergenic
939742088 2:145920932-145920954 TGTAATGCAAAACAATATCTTGG - Intergenic
948621036 2:239234805-239234827 TGGGCTTCAAATTAATATTCTGG - Intronic
1169484710 20:6018750-6018772 TTTGATAAAATTTAATATCCAGG - Intronic
1169902381 20:10566644-10566666 TGTGATGCAAATTATGAGGCAGG - Intronic
1172676822 20:36678375-36678397 GGAGATGCAAATTAAAACCCAGG + Intronic
1172720143 20:36993911-36993933 TGTGATAGAAATGAAAATCCTGG + Intergenic
1173028276 20:39330006-39330028 TGTGATGCAAATTCATGTCACGG - Intergenic
1173696031 20:45013892-45013914 TGTCATCCAAAATAATATACTGG + Intronic
1176892929 21:14340368-14340390 TGTGTTGCTCATTAATATCTTGG + Intergenic
1178754440 21:35335172-35335194 TGTGAGTCAAAATAATTTCCTGG - Intronic
1184320254 22:43736549-43736571 TGTGAGCCCAATAAATATCCTGG - Intronic
1184320266 22:43736618-43736640 TGTGAGCCCAATAAATATCCTGG - Intronic
949698298 3:6725362-6725384 TGTGATGCAAATAAACTTCAAGG - Intergenic
951575395 3:24108112-24108134 TTTGATGCACATTAAAATCTGGG + Intergenic
952802743 3:37312146-37312168 TGAGATGCAATTTTATATGCTGG + Intronic
953098427 3:39801975-39801997 TGTCATGCACAAAAATATCCAGG - Intergenic
953271706 3:41451829-41451851 TGTGATTCAATGTAATATCAAGG + Intronic
953362533 3:42310416-42310438 TGTGATACAAAGTTAAATCCAGG + Intergenic
953651760 3:44811909-44811931 AGTGATTAAAATTAAAATCCTGG - Intronic
957714704 3:83911501-83911523 TATGATGCAAACTACAATCCAGG - Intergenic
958727028 3:97918517-97918539 TCTGTTGCAAATAAGTATCCTGG + Intronic
959750770 3:109831888-109831910 TGGGATGCTAATTAATTACCTGG - Intergenic
960056247 3:113278549-113278571 AGTGATGCAAATAAGCATCCGGG - Intronic
964969604 3:162543267-162543289 TGTGATACAAATGTATATTCTGG - Intergenic
971107865 4:23546742-23546764 TGTGATCCAAATGAATACTCTGG - Intergenic
975705153 4:77104409-77104431 TCTATTGCAAATTAATATGCAGG - Intergenic
977459653 4:97309202-97309224 TGTCATGCAATTACATATCCAGG - Intronic
978113382 4:104989726-104989748 TTTGCTGAAAATTAATATGCCGG + Intergenic
979969067 4:127112520-127112542 AGTGACACAAATTAATTTCCAGG - Intergenic
981105597 4:140877049-140877071 TGTGATCTAATTTAATATACAGG - Intronic
981132928 4:141178366-141178388 TGTGATGCAAAGCTATATCAAGG + Intronic
981867821 4:149446564-149446586 TGTAATTCACATTAAGATCCTGG - Intergenic
983528589 4:168785961-168785983 TGTGATTCACATTAATATTTTGG + Intronic
984812697 4:183808505-183808527 TTTGTTACAAATTAATAACCAGG - Intergenic
984923226 4:184784040-184784062 TGGGATACAAATTAAAATCTAGG - Intronic
985266683 4:188157764-188157786 TGTGTTTGAAAATAATATCCGGG + Intergenic
988296344 5:29367781-29367803 TTTTATGGAAATTAATATCTTGG - Intergenic
989818964 5:45771076-45771098 TGGGATCAAAATTAATATGCTGG + Intergenic
991053610 5:62298671-62298693 TTTGTTGGAAATTATTATCCTGG - Intergenic
992543807 5:77790354-77790376 TGTGATGCAAATTTTTTTCCAGG + Intronic
993518978 5:88875407-88875429 TGTGATGCAAATTAGCATTGAGG - Intronic
994035744 5:95198678-95198700 TTTGATGCAAATTAATTTCACGG + Intronic
994758424 5:103823086-103823108 GGTGATGCACATTTGTATCCTGG - Intergenic
995405985 5:111796463-111796485 TGGGATGCCAATTAATATAGTGG - Intronic
996787185 5:127251865-127251887 TATAATGCAAATATATATCCAGG - Intergenic
998618654 5:143770428-143770450 TGTTATGAAAAGTAAAATCCAGG + Intergenic
1000727365 5:164788501-164788523 GGTAATGCAAATTAATACCCAGG + Intergenic
1002977827 6:2102372-2102394 TATGAAGAAAATTAATATGCTGG + Intronic
1003943937 6:11056417-11056439 TGAGCTGGGAATTAATATCCAGG + Intergenic
1004851132 6:19700243-19700265 TGTAATGCAATTTATTCTCCTGG - Intergenic
1006640727 6:35488334-35488356 TGTGGTCCAAATTAATAGCCTGG - Intronic
1008384585 6:50874181-50874203 TGTGATGTAAATTAATAGCTTGG + Intergenic
1010065210 6:71674371-71674393 AGTGATGCAAATTAAGGTCTGGG + Intergenic
1010392615 6:75354832-75354854 TGTGATGAAAATTACTTTCCAGG - Intronic
1015174883 6:130296064-130296086 CTTGATGCAAATCAGTATCCAGG + Intronic
1018402445 6:163438282-163438304 TGTGATGTAAAATTATATTCTGG - Intronic
1022331694 7:29385420-29385442 TGTGATGTTTATTAACATCCTGG + Intronic
1025070866 7:55897619-55897641 TTTGTTGCTAATAAATATCCTGG - Intronic
1027543926 7:79502725-79502747 TGTGATGGAGATTAGTATACAGG + Intergenic
1027738047 7:81960665-81960687 TATGATGCAATTTAACATCTTGG + Intronic
1027942433 7:84701315-84701337 TTTGATTAAAATTTATATCCAGG + Intergenic
1028112420 7:86958006-86958028 TGTGATGCAAATTAATATCCTGG - Intronic
1031476879 7:122233974-122233996 TGTGATTAGAATTAAGATCCTGG + Intergenic
1036144337 8:6240267-6240289 TGTGGTGCAATATAAAATCCAGG - Intergenic
1037551398 8:19975131-19975153 AGTGATGCAAATCAATTTCTGGG - Intergenic
1038721061 8:30035676-30035698 TGTGGTTCAACTTAATATACTGG + Intergenic
1040001622 8:42581841-42581863 TGGCATGCTAATTAATATTCAGG - Intergenic
1040619519 8:49074732-49074754 TGTGGTGCAAATTACTAGACAGG + Exonic
1040788049 8:51190360-51190382 TGTGATGCATATTCAAATGCAGG + Intergenic
1041874690 8:62674624-62674646 TGTTAAGCAAATTTATAGCCAGG - Intronic
1044297042 8:90540735-90540757 TGTGTTGAAAATTATTATTCAGG - Intergenic
1047798553 8:128284505-128284527 TGTGAAGCACATTGAGATCCTGG + Intergenic
1052581312 9:30358634-30358656 TGAGATTCATATGAATATCCAGG - Intergenic
1053538417 9:38948724-38948746 TGTGCTGCAAAGTAATGTACAGG + Intergenic
1054627721 9:67415195-67415217 TGTGCTGCAAAGTAATGTACAGG - Intergenic
1058480694 9:105391444-105391466 TGAGTTGCAAATTAATTGCCAGG + Exonic
1059092271 9:111372308-111372330 TGGGATGCATATTAAGGTCCTGG + Intronic
1188437204 X:30174712-30174734 TGTCATGCAAATAAATATACAGG + Intergenic
1188632170 X:32377184-32377206 TGTGATGAAAATTAATATACTGG - Intronic
1193873240 X:86828147-86828169 TGTGAGACAAATTAAAATGCAGG + Intronic
1193929070 X:87529993-87530015 TGTGATAAAAATTCATCTCCTGG + Intronic
1195646712 X:107238954-107238976 TGATATTCAAATTGATATCCAGG + Exonic
1195762574 X:108262659-108262681 TGTGAGGCAAATAAACATACAGG + Intronic
1199151075 X:144487581-144487603 TTTGATTCAAATTAATATTTTGG - Intergenic
1201016785 Y:9612080-9612102 TGTGATGTAAATGAATCTTCAGG + Intergenic