ID: 1028114356

View in Genome Browser
Species Human (GRCh38)
Location 7:86981001-86981023
Sequence GATTCTGGGTGTTCATCTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028114355_1028114356 -10 Left 1028114355 7:86980988-86981010 CCTTTGCACTACAGATTCTGGGT 0: 1
1: 0
2: 0
3: 19
4: 229
Right 1028114356 7:86981001-86981023 GATTCTGGGTGTTCATCTGATGG No data
1028114351_1028114356 16 Left 1028114351 7:86980962-86980984 CCTTTCTGGACTGTATCACTCAG 0: 1
1: 0
2: 0
3: 23
4: 321
Right 1028114356 7:86981001-86981023 GATTCTGGGTGTTCATCTGATGG No data
1028114349_1028114356 30 Left 1028114349 7:86980948-86980970 CCTGGAGAGGCTGACCTTTCTGG 0: 1
1: 0
2: 2
3: 22
4: 252
Right 1028114356 7:86981001-86981023 GATTCTGGGTGTTCATCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028114356 Original CRISPR GATTCTGGGTGTTCATCTGA TGG Intronic
No off target data available for this crispr