ID: 1028121393

View in Genome Browser
Species Human (GRCh38)
Location 7:87059637-87059659
Sequence GCAGCAGAGCTGTCAGCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 236}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028121393_1028121404 24 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121404 7:87059684-87059706 CGATGCTCCCGTCACGCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1028121393_1028121398 -9 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121398 7:87059651-87059673 CTCTGCTGCGCTCGCGGCCCGGG 0: 1
1: 0
2: 1
3: 23
4: 154
1028121393_1028121402 21 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121402 7:87059681-87059703 CGCCGATGCTCCCGTCACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 29
1028121393_1028121407 29 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121407 7:87059689-87059711 CTCCCGTCACGCCGGAGGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1028121393_1028121406 28 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121393_1028121405 25 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121405 7:87059685-87059707 GATGCTCCCGTCACGCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1028121393_1028121397 -10 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121397 7:87059650-87059672 GCTCTGCTGCGCTCGCGGCCCGG 0: 1
1: 0
2: 2
3: 10
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028121393 Original CRISPR GCAGCAGAGCTGTCAGCGGG CGG (reversed) Exonic
900744630 1:4352737-4352759 GCAGCAGGGCTGGCAGCAGCAGG - Intergenic
901698221 1:11027041-11027063 GCTGCAGAGGTGACAGCGGAGGG - Exonic
901877459 1:12175125-12175147 TCTTCCGAGCTGTCAGCGGGAGG + Intronic
902403831 1:16172475-16172497 GGAGCAGAGCTGGCACCAGGAGG + Intergenic
902548931 1:17208000-17208022 GCAGCTGGGCTGGCAGCAGGAGG + Intronic
902995263 1:20219911-20219933 GCAGCAGAGCTTTTACAGGGAGG + Intergenic
903845194 1:26275697-26275719 TAAACAGAGCTGTCAGCAGGGGG + Intronic
903995631 1:27303820-27303842 GCAGCCCAGTTGGCAGCGGGAGG + Intronic
904319191 1:29685515-29685537 GCAGCAGAGCTAACAGAAGGAGG - Intergenic
904899636 1:33846824-33846846 GCAGCAGAGATGACACCTGGAGG - Intronic
905688611 1:39926667-39926689 CCAGCAGAGCAGTCAGCATGAGG - Intergenic
906353675 1:45084785-45084807 GGAGCTGAGCTCTCAGGGGGTGG - Intronic
906544924 1:46613939-46613961 GCCGCCCAGCTGGCAGCGGGAGG - Intronic
907443155 1:54490601-54490623 GGCGCAGAGCTGACTGCGGGAGG + Intergenic
910891063 1:92020788-92020810 GGAGCAGAGCAGTCAGCAGCTGG + Intergenic
915755650 1:158256910-158256932 GCAGCAGGGCACTCAGCGAGGGG + Exonic
919755805 1:201065786-201065808 GCACCAGGGCTGGGAGCGGGAGG + Intronic
920164610 1:204026656-204026678 GCGACAGGGCTGTCAGCGTGGGG + Intergenic
920400370 1:205672335-205672357 GCAGCAGACCTGCCTGCTGGAGG + Intronic
924517792 1:244780657-244780679 GCAGGAGAGATGTCCGCGAGTGG - Intergenic
1066207973 10:33208420-33208442 GCAGCAGCACTGGCAGTGGGTGG - Intronic
1067078561 10:43201633-43201655 CCAGCTGAGCTGTCATCTGGGGG + Intronic
1067145310 10:43689714-43689736 GCCCCGGAGCTGTGAGCGGGAGG + Intergenic
1067273191 10:44810280-44810302 ACAGAAGAGTTGGCAGCGGGGGG + Intergenic
1069357290 10:67601425-67601447 GCAGCTGATCTGTCAGGAGGTGG + Intronic
1071589835 10:86862355-86862377 GCAGCAGGACTGTGAGCGGCAGG + Intronic
1072739128 10:97899184-97899206 GCAGCAGAGAGGACAGCGAGAGG - Intronic
1073340897 10:102743920-102743942 GGAGCAGAGCCGGAAGCGGGAGG + Intergenic
1075688318 10:124379079-124379101 TCAGCAGAGATCTCAGCGTGGGG + Intergenic
1075726463 10:124613210-124613232 GCTGCAGAGGGGTCAGCGTGGGG + Intronic
1076370979 10:129953563-129953585 GCCGCAGAGATGCCAGCGAGTGG + Intronic
1077384329 11:2261882-2261904 GCTGCAGGGCTGTCGGAGGGTGG - Intergenic
1078523578 11:12083652-12083674 GCAGCAGTCCTGTCATCGGCAGG - Intergenic
1079114081 11:17629433-17629455 GCAGCAGAGCTGTCAGGGCAGGG + Intronic
1081791922 11:45794257-45794279 GCAGAAGGGCTGCCAGCAGGTGG - Intergenic
1083894809 11:65614479-65614501 GCAGCAGAGCACGCAGCTGGGGG - Intronic
1083934481 11:65863195-65863217 TCAGCAGAGCTGTGAGGAGGAGG + Exonic
1084969732 11:72764589-72764611 GCAGCAGTGCTGCCTGCTGGGGG - Intronic
1086665569 11:89477346-89477368 GCAGCTGATCTGACAGCAGGTGG + Intronic
1087893157 11:103557877-103557899 GGAGCAGAACTGTCAGAGAGCGG + Intergenic
1089192184 11:116661108-116661130 GCAGCAGGGCAGTCGGGGGGAGG - Intergenic
1089376755 11:118000055-118000077 GCATCAGAGCTTCCAGCAGGAGG + Exonic
1089467648 11:118695773-118695795 GCAGCAGAGCTGGCAGGGCAGGG + Intergenic
1090417191 11:126548614-126548636 GGTGCAGAGGTGCCAGCGGGAGG - Intronic
1090818966 11:130323881-130323903 GGAGCACAGCTGTCTGAGGGTGG - Intergenic
1091214112 11:133889989-133890011 TCAGCACAGCTGTCCTCGGGAGG - Intergenic
1093251370 12:16808236-16808258 GCAGCTGATCTGTCAGGAGGCGG - Intergenic
1094196239 12:27752834-27752856 GCAGCAGAGTTGTGGGCGAGAGG + Intronic
1096156967 12:49346339-49346361 GGAGAAGAGCTGTTACCGGGAGG - Intergenic
1097036246 12:56126360-56126382 GCAGCAGAATTGTCAGTGGGCGG + Exonic
1098463038 12:70754421-70754443 GAAGCAGCTCTGGCAGCGGGGGG - Intronic
1100314590 12:93432999-93433021 GCAGCAGAGCTTGCAGTGAGCGG - Intronic
1100386704 12:94110509-94110531 GCAGCTGAGCTGACAGGAGGCGG - Intergenic
1101782148 12:107845844-107845866 GCCCCAGAGCTGACCGCGGGAGG + Intergenic
1102514898 12:113439862-113439884 CCAGCAGAGCTGTGAGGGGTTGG - Intergenic
1105458242 13:20560656-20560678 GCAGCAGATCTGCAAGAGGGTGG - Intergenic
1106408732 13:29496464-29496486 GCAGGAGAGCTGGCTGCGAGAGG + Intronic
1107836769 13:44417987-44418009 GAAGCAGAGGTGGCAGCAGGAGG - Intergenic
1113102797 13:106738303-106738325 GCAGCAGGCCAGTCAGGGGGAGG - Intergenic
1113937142 13:114000446-114000468 CCAGCAGATCTGACAGCGAGGGG + Intronic
1113972501 13:114200516-114200538 GCAGAAGAGCTGCCCGTGGGTGG + Intergenic
1114412873 14:22517298-22517320 GCAGCAGAGCTGGAATTGGGGGG + Intergenic
1114550992 14:23532834-23532856 GCAGCAAAGCTTGCAGCGGTGGG + Exonic
1118817611 14:69324169-69324191 GCAGCAGGGCTGTCAGTGTTGGG + Intronic
1118965930 14:70585388-70585410 GCTGCTGAACTGTCAGCAGGTGG - Intronic
1122324866 14:100875917-100875939 GCAGCAGGGCTCTGAGCGGGTGG + Intergenic
1122939240 14:104973855-104973877 GCAGCAGAGCTGGCAGGGCAGGG + Intronic
1126106617 15:45151005-45151027 GGATCAGAGCTGTCAGCAAGGGG - Intronic
1127684348 15:61327372-61327394 GCAGCAGAGTTGACAGGGAGTGG + Intergenic
1127920228 15:63488579-63488601 GCTGCAAATCTGTCAGCCGGAGG + Intergenic
1128323498 15:66708041-66708063 GCAGAAGAGCAGTCAGCCAGGGG - Intronic
1128727771 15:70000489-70000511 GCATCAGGGCTCTCAGCAGGAGG - Intergenic
1129179157 15:73860707-73860729 GGAGCAGGGCTGTCAGGGGAGGG + Intergenic
1129408380 15:75334959-75334981 GTGGCAGAGCTGGCAGCGAGTGG + Intergenic
1131095631 15:89652810-89652832 GCATCAGAGCTGCCTGCAGGTGG - Exonic
1132374009 15:101316607-101316629 TCTGCTGAGCTGCCAGCGGGTGG + Intronic
1132996831 16:2827863-2827885 CCAGCACAGCTGTCAGAGGCAGG - Intergenic
1139375853 16:66495754-66495776 GCTGGAGAGCTGTCAGGGTGTGG + Intronic
1140535286 16:75704228-75704250 GCAGCAGAGCTTGCAGTGAGCGG - Intronic
1141155935 16:81597195-81597217 TCAGCAGAGCTGTCACAAGGTGG + Intronic
1141816476 16:86413455-86413477 ACAGGAGAGCTGTGAGCGAGGGG - Intergenic
1142007944 16:87699001-87699023 ACAGCAGCGCGGTCTGCGGGGGG + Intronic
1142134434 16:88445081-88445103 GCAGCAGAGCACTGAGCTGGGGG + Intergenic
1143598600 17:7929937-7929959 GCTGCAGAGCCTTCAGCAGGCGG - Intronic
1146393315 17:32442760-32442782 GCAGCTGATCTGACAGGGGGCGG - Intergenic
1146456453 17:33013344-33013366 GCGGCACAGCAGCCAGCGGGTGG - Exonic
1146483547 17:33225013-33225035 GCAGCAGAGATGGGAGTGGGTGG - Intronic
1147524857 17:41212917-41212939 GCAGCAGGGCTGGCAGCAGCTGG - Intronic
1147526315 17:41227067-41227089 GCAGCAGGGCTGGCAGCAGTTGG - Exonic
1147526840 17:41232869-41232891 GCAGCAGGGCTGGCAGCAGTTGG - Exonic
1147527346 17:41238419-41238441 GCAGCAGGGCTGGCAGCAGTTGG - Exonic
1147528468 17:41250088-41250110 GCAGCAGGGCTGGCAGCAGTTGG - Exonic
1147528994 17:41255783-41255805 GCAGCAGGGCTGGCAGCAGCTGG - Exonic
1147530487 17:41271723-41271745 GCAGCAGGGCTGGCAGCAGCTGG - Intergenic
1147705280 17:42421755-42421777 GCAGCAGCGCAGCCGGCGGGAGG - Intronic
1147805218 17:43126392-43126414 GCGGCAGAGCTGGCAGCGGACGG + Intergenic
1148717365 17:49725228-49725250 GCAGAAGAGCAGTCAGCCTGAGG - Intronic
1149552778 17:57552392-57552414 GCAGCAGGGCAGTGAGTGGGGGG - Intronic
1151649231 17:75456094-75456116 TCAGCCGAGCTGGAAGCGGGAGG + Intronic
1151677436 17:75605875-75605897 GGAGCAGGGCTGGCAGCGGCTGG + Intergenic
1152046903 17:77942787-77942809 GCAGGAGAGCCGTCAGCGGAGGG - Intergenic
1152137712 17:78514719-78514741 GCAGCAGAGCTGGCCGCCAGGGG + Intronic
1155997315 18:32343881-32343903 GCAGCAGAGCTGGGAGTGGGGGG - Intronic
1156587785 18:38451104-38451126 TGAGCAAAGCTGTCAGTGGGTGG - Intergenic
1157901188 18:51519611-51519633 GGAGCAGCACTGTCAGTGGGGGG - Intergenic
1158392219 18:57052944-57052966 GCAGCAGGGCTGTCACCCAGAGG + Intergenic
1158546676 18:58403521-58403543 GCTGCAGAGCTGTGAGGGAGGGG - Intergenic
1158931064 18:62325376-62325398 GCAGCAGCGCGAACAGCGGGCGG - Exonic
1160660016 19:293531-293553 ATAGCAGAGCTGGAAGCGGGTGG + Intergenic
1161076687 19:2289361-2289383 GCACCAGAGCTGACCGCAGGGGG - Intronic
1161301472 19:3544924-3544946 GCAGCAGAGCTCTGAGCTGTGGG + Exonic
1161330416 19:3684176-3684198 ACTGCAGCGCTGTGAGCGGGAGG - Intronic
1162442594 19:10702079-10702101 ACCGCAAAGCTGTCAGGGGGTGG - Intronic
1163441735 19:17325329-17325351 GCAGCAGCGCAGGCGGCGGGAGG - Exonic
1166366399 19:42280597-42280619 GCACCCGAGCTGTCTGCGGTGGG - Intronic
1166369920 19:42294979-42295001 GCAGCAGCGGTGCCAGTGGGGGG - Exonic
1166541328 19:43607839-43607861 GCAGCAGAGCCGGCAGGGTGGGG + Exonic
1166727403 19:45037412-45037434 GCAGCAGGGCTGACGGCGGGAGG - Exonic
1167101940 19:47409083-47409105 GCAGCAGGGCTCTCACCGAGAGG + Exonic
1167246046 19:48373791-48373813 CCAGGAGGGCTGTGAGCGGGAGG - Intronic
1167390771 19:49193566-49193588 TCAACAGAGCTCTCAGTGGGGGG - Intronic
1168026689 19:53648382-53648404 GCTGCAGAGCTGTCTGGTGGGGG - Intergenic
1168293859 19:55369603-55369625 GCGGGAGAGCTGGCGGCGGGGGG + Intronic
925068993 2:951243-951265 GGAGCAGAGCGGCCAGGGGGCGG - Intronic
925583163 2:5435237-5435259 GCAGCAGAGCTGAGAGCCGAGGG - Intergenic
925981984 2:9184450-9184472 GCAGTGGACTTGTCAGCGGGGGG + Intergenic
927519196 2:23689020-23689042 CCTGCAGAGCTGTGAGGGGGTGG - Intronic
929538980 2:42805129-42805151 ACAGCACAGCTGCCAGTGGGCGG - Intergenic
930049663 2:47205329-47205351 GCTGCAGAGCTTTCAGGAGGCGG + Intergenic
931460597 2:62447248-62447270 GATGCAGAGCTCTCAGAGGGTGG - Intergenic
932763956 2:74458529-74458551 GCAGCAGAGGTGGCAGGGGCGGG + Exonic
933909984 2:86930806-86930828 GCAGCAGAGGTGGCAGGGGCGGG - Intronic
934022741 2:87972582-87972604 GCAGCAGAGGTGGCAGGGGCGGG + Intergenic
934783949 2:96991089-96991111 GAAGGAGAGCTGTTAGTGGGAGG + Intronic
937049748 2:118878819-118878841 GCAGCTGAGCTGTCAGGGAAGGG - Intergenic
940984254 2:160037003-160037025 ACAGCAGAGCTGTCAGGTGTTGG - Intronic
941677061 2:168355195-168355217 GCTGCAGAGCTGTGGGAGGGAGG - Intergenic
946358866 2:219207020-219207042 GGAGCCGAGCTGTCAGCGCTTGG + Exonic
948486322 2:238283565-238283587 GGAGCAGAGCGGGCAGCGGTAGG + Intronic
948861801 2:240756182-240756204 GCAGCAGTGCTGACAGCTGAAGG - Intronic
949026976 2:241770860-241770882 GCAGCAGGGCTGTCATGGGCAGG - Intergenic
1168886943 20:1266559-1266581 GCGGCCCAGCTGTCAGCGGCCGG + Intronic
1174134907 20:48372909-48372931 GCAGCAAAGCAGTCAGGGTGAGG + Intergenic
1175171379 20:57083888-57083910 GCAGCAGAGCAGCCAGAGTGAGG - Intergenic
1175855358 20:62118149-62118171 GAAGACGGGCTGTCAGCGGGAGG - Intergenic
1175858521 20:62135936-62135958 ACAGCAGAACTGCCAGTGGGGGG + Intergenic
1176384970 21:6134683-6134705 CCAGCAGAGCTTGCAGGGGGTGG + Intergenic
1179165088 21:38929162-38929184 GCAGCATGGCTGGCAGCTGGTGG - Intergenic
1179738503 21:43403569-43403591 CCAGCAGAGCTTGCAGGGGGTGG - Intergenic
1179950973 21:44708691-44708713 GCAGGAAGGCTGTCAGCTGGTGG - Intronic
1180872312 22:19153300-19153322 GCAGCAGAACTGACATCGTGTGG + Intergenic
1181594416 22:23905083-23905105 GCAGCACAGTTGTCAGCAGTTGG - Intergenic
1184256555 22:43290365-43290387 GCAGCAGAGCTGTGAGGTGGCGG - Intronic
1184274160 22:43400652-43400674 GCAGCCGGGCTGGCGGCGGGTGG + Intergenic
1184453430 22:44596230-44596252 GTAGGGGAGCTCTCAGCGGGGGG + Intergenic
949459228 3:4272544-4272566 GCAGCAGACCTGGAAGCGGGAGG + Intronic
950005737 3:9689930-9689952 GGAGCAGGGCTGTGAGCCGGGGG - Intronic
950335282 3:12188294-12188316 GCAGCAGAGCTGTCTTTGGGAGG + Intronic
950423132 3:12910393-12910415 GCAGCAAAGCTCCCAGCAGGGGG - Intronic
950718243 3:14864707-14864729 GCAGCAGTGCTGTGAGGGGATGG + Intronic
951072535 3:18349204-18349226 GAAGAAGAGCTGTCAGTGGAAGG - Exonic
952052183 3:29397685-29397707 ACAGAAGAGCTGTAAGGGGGAGG - Intronic
952744472 3:36764292-36764314 GGAGCAGAGGTGGCAGCGCGGGG + Intergenic
952866136 3:37856422-37856444 GCAGAAGAGCAATCAGAGGGTGG - Intergenic
956252781 3:67252452-67252474 GCAGCAGAGCTTGCAGTGAGTGG - Intergenic
959000419 3:100957773-100957795 GGAGCTGAGCTGTGAGCAGGCGG - Intronic
960187287 3:114659424-114659446 GCAGCTGGTCTGTCAGAGGGCGG - Intronic
961043992 3:123696348-123696370 GTAGCAGAGCTGACAGGGTGGGG + Intronic
961604522 3:128083697-128083719 GCAGCAGTGGTGGCCGCGGGTGG - Intronic
961785525 3:129344574-129344596 GCAGCAGGGCTGTCCTCCGGAGG + Intergenic
962552496 3:136509442-136509464 GCAGCAGAGCTGAAAGTGGCTGG - Intronic
963096846 3:141551573-141551595 GAGGCAAAGCTGTCAGCAGGAGG - Intronic
963271359 3:143289101-143289123 ACAGCTGAGCTGTCAGTGGTAGG + Intronic
964690473 3:159444148-159444170 GCAGCACAGCTGTGAGCAAGGGG + Intronic
965743669 3:171903013-171903035 GGAGCAGAGCTGTCTTGGGGTGG - Intronic
967194951 3:187018038-187018060 GCAGCAGAGCTGTCAAAGATGGG - Intronic
968541382 4:1170034-1170056 GCAGCATAGCTGTCACCCGGTGG + Intronic
968884595 4:3320936-3320958 GCAGCAGAGTTGGCACAGGGAGG + Intronic
969161928 4:5267880-5267902 GCAGCAGAGCTGTCAACTTCTGG - Intronic
969526599 4:7706977-7706999 GCAGCAGAGCTGGTTGAGGGTGG - Intronic
969584390 4:8083717-8083739 GGACTAGAGCTGTCAGCGGCAGG + Intronic
969642759 4:8408991-8409013 GCTGCAGAGCTGCCTGCTGGTGG + Intronic
969715954 4:8868228-8868250 GCAGCGGAGCTGGCGGCGCGTGG - Exonic
972627031 4:40809332-40809354 GCTGAAGAGCGGTCAGCTGGCGG - Exonic
975290315 4:72670653-72670675 CCAGCAGAGGTGTCAGCTGCAGG - Intergenic
976149052 4:82074947-82074969 GCCACAGAGCTGCCAGCAGGAGG - Intergenic
979482606 4:121237173-121237195 GCAGCAGAGTGCTCTGCGGGAGG + Intergenic
983908995 4:173215576-173215598 GGATCAGAGCTGTGAGCTGGGGG + Intronic
985029457 4:185774181-185774203 GCAGCAGGGCAGCCAGCGCGGGG + Intronic
995960525 5:117832801-117832823 GCAGTCAAGCTGTCAGCAGGTGG - Intergenic
997028972 5:130100250-130100272 GCAGCAGAGCTTGCAGTGAGCGG - Intronic
997956844 5:138285508-138285530 TCAGCAGAGCTGAAAGCTGGTGG - Exonic
999922973 5:156342817-156342839 GCAGCAGAGCTGGTAGCAGATGG + Intronic
1001204912 5:169753364-169753386 ACAGGGGAGCTGTCAGGGGGTGG - Intronic
1003150260 6:3542255-3542277 GCAGCAGGGCTGTGTGCAGGTGG + Intergenic
1005799911 6:29410261-29410283 GGAGCAGAGCTCCCAGAGGGAGG + Intronic
1006807678 6:36799135-36799157 GCTGCAGAGATGCCAGTGGGTGG - Intronic
1006985855 6:38175128-38175150 GCAGCAGAGCAGCCAGAAGGAGG - Exonic
1017072374 6:150586912-150586934 GCAACAGAGCTGTTAGTGGGAGG - Intergenic
1018901339 6:168053336-168053358 GAAACAGAGCTGGCAGTGGGAGG - Intergenic
1019516812 7:1443807-1443829 CCTGCAGAGCTGTGAGGGGGTGG + Intronic
1023188135 7:37552210-37552232 TGAATAGAGCTGTCAGCGGGAGG + Intergenic
1023826810 7:44015211-44015233 GCAGCACAGCCGCCAGCGGCTGG + Intergenic
1024970704 7:55067091-55067113 GCAGCACTGCTGTCAGGGTGAGG + Intronic
1027958041 7:84907087-84907109 GCAGCAGAGATAGCAGTGGGTGG + Intergenic
1028121393 7:87059637-87059659 GCAGCAGAGCTGTCAGCGGGCGG - Exonic
1028239900 7:88406952-88406974 GCAGCAGGGCTGAGAGAGGGAGG - Intergenic
1029188447 7:98755550-98755572 GCAGCTGAGCTGACTGTGGGAGG - Intergenic
1029525201 7:101089630-101089652 GAGGCAGAGCTGTCCGTGGGAGG + Exonic
1029737962 7:102474962-102474984 GCAGCACAGCTGCCAGCGGCTGG + Intronic
1029755095 7:102568612-102568634 GCAGCACAGCCGCCAGCGGCTGG + Intronic
1029773044 7:102667692-102667714 GCAGCACAGCCGCCAGCGGCTGG + Intronic
1032780331 7:135160640-135160662 ACAGCAGAGCTGCCTGAGGGAGG - Intronic
1034151537 7:148920500-148920522 GCATCATGGCTGTCACCGGGAGG + Intergenic
1034815900 7:154171667-154171689 GCAGCACAGCTCTCAGAGGAGGG - Intronic
1034979586 7:155467392-155467414 GCAACAGAGCTGCCAGCGCCAGG - Intergenic
1035607414 8:939004-939026 GCAGCAGAGCAGCCACCGGCAGG + Intergenic
1036596867 8:10221024-10221046 ACTGCAGAGCTGTCAGTGTGAGG - Intronic
1036764324 8:11537618-11537640 GTGGCAGAGCTGGCAGCTGGAGG - Intronic
1037986053 8:23291276-23291298 CCTGCAGAGCTCTCAGCGCGTGG + Intronic
1038415874 8:27395563-27395585 GGTGCAGAGCTGGCAGCAGGTGG - Intronic
1038731786 8:30134613-30134635 GCAGCAGAGGTTGCAGTGGGCGG - Intronic
1040334296 8:46408269-46408291 GCCCCAGGGCTGTCAGGGGGCGG + Intergenic
1041382626 8:57266839-57266861 TCTGCAGAGCTGACAGCTGGAGG + Intergenic
1041439732 8:57881880-57881902 GCAGCTGATCTGACAGAGGGTGG - Intergenic
1043493958 8:80779984-80780006 GCAGCAAAGCTCTCATGGGGAGG + Intronic
1047191662 8:122683741-122683763 GCAGCAAAGCTGGGAGAGGGAGG + Intergenic
1047893604 8:129340679-129340701 GCAGCAGATCTTACAGAGGGTGG - Intergenic
1048082599 8:131145486-131145508 GCTGCAGAGGTGTGTGCGGGGGG + Intergenic
1049022319 8:139965959-139965981 GCACCAGGCCTGTCTGCGGGAGG + Intronic
1049574789 8:143385042-143385064 GCAGCAGAGTCGGCAGCGGTGGG + Intergenic
1056277821 9:85010649-85010671 GGAGCGGGGCTGTCAGCAGGAGG + Intronic
1056729116 9:89149259-89149281 CCTGCAGAGCTGGCAGAGGGAGG - Intronic
1057427442 9:94964217-94964239 GCAACAGAGCAGTGAGCTGGAGG - Intronic
1057841187 9:98486701-98486723 GCAGCTGAGCTGTTAGAGGCTGG + Intronic
1058133612 9:101281953-101281975 GCAGCAAAGCTGTCAGCTCCTGG - Intronic
1059357535 9:113711577-113711599 GGAGCCGAGATGTCAGAGGGTGG + Intergenic
1060269957 9:122133250-122133272 GTAGCAGAGCTGTCACTGAGAGG - Intergenic
1060300247 9:122370943-122370965 GCAGCCGAGGTGACAGCTGGAGG + Intronic
1060827124 9:126693784-126693806 GCAGCAGAACTCCCAGCGGCTGG + Exonic
1062239757 9:135530334-135530356 GAGGCAGAGCTGACAGCTGGAGG - Intergenic
1186435996 X:9543549-9543571 GAGGCAGAGCTGTCAGAGTGTGG + Intronic
1187507205 X:19887475-19887497 GCAGCAGAGGCAGCAGCGGGCGG - Exonic
1188935424 X:36170062-36170084 GCTGCAGAGCTGTCAAAAGGAGG + Intergenic
1190581370 X:51894944-51894966 GCAGCGGAGCTGCAGGCGGGCGG - Intronic
1192902412 X:75514358-75514380 GCAACAGAGCTGTAAACGGCTGG + Intronic
1193311154 X:80012431-80012453 GCAGCAGTGCGGTCTGCTGGGGG - Intergenic
1194522719 X:94938222-94938244 GCAGCAGAGCTTGCAGTGAGTGG - Intergenic
1194594092 X:95836515-95836537 GGAACAGAGCTCTCAGAGGGAGG - Intergenic
1196555379 X:117078987-117079009 GCATCAGAGCTGACAGAAGGAGG + Intergenic