ID: 1028121394

View in Genome Browser
Species Human (GRCh38)
Location 7:87059640-87059662
Sequence AGCGCAGCAGAGCTGTCAGC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 177}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028121394_1028121407 26 Left 1028121394 7:87059640-87059662 CCCGCTGACAGCTCTGCTGCGCT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1028121407 7:87059689-87059711 CTCCCGTCACGCCGGAGGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1028121394_1028121406 25 Left 1028121394 7:87059640-87059662 CCCGCTGACAGCTCTGCTGCGCT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121394_1028121404 21 Left 1028121394 7:87059640-87059662 CCCGCTGACAGCTCTGCTGCGCT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1028121404 7:87059684-87059706 CGATGCTCCCGTCACGCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1028121394_1028121402 18 Left 1028121394 7:87059640-87059662 CCCGCTGACAGCTCTGCTGCGCT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1028121402 7:87059681-87059703 CGCCGATGCTCCCGTCACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 29
1028121394_1028121405 22 Left 1028121394 7:87059640-87059662 CCCGCTGACAGCTCTGCTGCGCT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1028121405 7:87059685-87059707 GATGCTCCCGTCACGCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028121394 Original CRISPR AGCGCAGCAGAGCTGTCAGC GGG (reversed) Exonic
901783254 1:11608492-11608514 GGCTCAGGACAGCTGTCAGCAGG + Intergenic
901797110 1:11686227-11686249 AGCGGAGAGGAGCTGTCAGCAGG - Intronic
902378947 1:16043674-16043696 AGCAGAGCAGAGCTGCCAACAGG - Intergenic
902410458 1:16208749-16208771 GGCCCAGCAGGGCTGGCAGCTGG - Exonic
903199661 1:21724390-21724412 AGCACAGCAGAGCTTTGATCAGG + Intronic
909183231 1:72450695-72450717 AGCAGGGCAGAGCTGTCATCAGG - Intergenic
912254839 1:108048166-108048188 AGCAAGGCAGAGCTGTCAGAAGG - Intergenic
913263971 1:117026393-117026415 AGCGCAGCAGGGCTTCCAGAGGG + Intronic
915603927 1:156939091-156939113 AGGGCAGTAGAGGTGGCAGCTGG - Intronic
917174067 1:172212083-172212105 ATTGTAGCAGAGCTGTCACCAGG + Intronic
920499477 1:206477275-206477297 AGAGCAGAGGAGATGTCAGCTGG + Intronic
920568994 1:207002116-207002138 AGTGCAGCAGAATTGTGAGCGGG + Intergenic
921696425 1:218215572-218215594 AGGACAGTGGAGCTGTCAGCAGG - Intergenic
921839150 1:219809892-219809914 ACCTCTGCAGAGCTGGCAGCTGG - Intronic
923999922 1:239539351-239539373 AGCCCAGATGAGCTGTGAGCTGG + Intronic
1069827092 10:71260985-71261007 AGGGCAGCAGAGCAGCCGGCTGG + Intronic
1069828307 10:71267800-71267822 TGAGCAGCTGAGTTGTCAGCTGG - Intronic
1069898829 10:71695538-71695560 AGAGCAGCAGAACTGCCAGGCGG + Intronic
1070398783 10:76034840-76034862 ATCGTAGCTCAGCTGTCAGCCGG + Intronic
1070704240 10:78626269-78626291 ATTGCAGCAGAGCTGATAGCTGG + Intergenic
1070934315 10:80281526-80281548 AGCCCAGCACAGCTGTGAGGAGG - Intronic
1074067783 10:110033541-110033563 AGCACAGCTGATCTGCCAGCTGG - Intronic
1079424533 11:20327548-20327570 AGCACAGCTGATCTTTCAGCCGG - Intergenic
1082030427 11:47599671-47599693 AGCCAAGCAGAGATGCCAGCAGG + Intergenic
1083074023 11:60018563-60018585 AACGCAGCAGTGGTTTCAGCTGG - Intergenic
1083621489 11:64051514-64051536 TGGGCGGCAGAGCTGTCGGCCGG + Intronic
1084969735 11:72764592-72764614 AGCGCAGCAGTGCTGCCTGCTGG - Intronic
1085803150 11:79610582-79610604 AGCCTGGCAGAGCTGACAGCTGG + Intergenic
1089365548 11:117918890-117918912 AGTGCAGCACAGCTGACAGCTGG - Intronic
1090399942 11:126442739-126442761 AGCGCACCAGACCTGCCAGGGGG - Intronic
1090922343 11:131217486-131217508 AGCCCTTCACAGCTGTCAGCAGG - Intergenic
1091214113 11:133889992-133890014 AGCTCAGCACAGCTGTCCTCGGG - Intergenic
1091383407 12:77472-77494 GGCGAAGCAGAGCTGTCTGGGGG + Intronic
1098031290 12:66257399-66257421 AGCTCAGCTATGCTGTCAGCTGG - Intergenic
1098433625 12:70446927-70446949 AGAGCCACAGAGATGTCAGCTGG + Intergenic
1102959659 12:117084563-117084585 AGCACAGCAGGGCTGCAAGCAGG - Intronic
1103743750 12:123108445-123108467 AGGGCAGAAGAGCTCTCACCGGG + Intronic
1106339486 13:28815386-28815408 AGGGCAGCACAGGTGTCTGCTGG - Intergenic
1106514732 13:30443945-30443967 AGAGCAGCAGAGCTGTACACAGG - Intergenic
1112346724 13:98596323-98596345 AGAGCAGCAGAGGTGTCTGCAGG - Intergenic
1112913839 13:104522482-104522504 AGTGCAGCACAGCTGCCCGCTGG - Intergenic
1113334309 13:109363602-109363624 AGCGCAGCACAGCCGTGGGCGGG - Intergenic
1113392356 13:109909702-109909724 TGCCCAGCAGTGCTGTCTGCAGG + Intergenic
1114502096 14:23177804-23177826 AGGGGAGCTGGGCTGTCAGCTGG - Intronic
1114678646 14:24463630-24463652 ACCTCAGCTGGGCTGTCAGCAGG - Intergenic
1116436113 14:44897221-44897243 TGCGCAGCTGCGCTGTCAGGCGG + Intergenic
1117008445 14:51446206-51446228 ATCGCAGCAGAGCTTTGAGCTGG + Intergenic
1118965931 14:70585391-70585413 AGAGCTGCTGAACTGTCAGCAGG - Intronic
1121351172 14:93174250-93174272 ACTGCAGCAGAGCAGCCAGCCGG - Intergenic
1122971590 14:105154456-105154478 AGTGGAGCAGAGAAGTCAGCAGG - Intronic
1126319707 15:47408887-47408909 AGTGCAGCAGAGCTTGCAGGAGG + Intronic
1127662478 15:61113079-61113101 AGCCCAGCAGAGCTGTCCCCAGG - Intronic
1131333641 15:91526016-91526038 AGAGCAGCAGGGCCGTAAGCAGG - Intergenic
1131400737 15:92123725-92123747 AAAGCAGCAGAGGAGTCAGCAGG - Intronic
1131580434 15:93637729-93637751 ATCACAGGTGAGCTGTCAGCAGG + Intergenic
1132685523 16:1160485-1160507 GGCTCAGGAGAGCTGGCAGCAGG + Intronic
1133155390 16:3871279-3871301 AGCGCTGCCGAGCTGGGAGCTGG + Intronic
1136028010 16:27482279-27482301 AGGGGAGCAGAGATGTCATCAGG - Intronic
1136055616 16:27687119-27687141 AGCTGAGCAGAGCTGGCAACAGG - Intronic
1137231093 16:46568739-46568761 AGCTCCACAGAGCTGCCAGCCGG - Intergenic
1137570689 16:49564551-49564573 AGCGAAGGACAGCTGGCAGCAGG + Intronic
1142015285 16:87742765-87742787 TGGCCAGCAGAGCTGTCTGCTGG - Intronic
1142032218 16:87844298-87844320 GGCACAGCAGCCCTGTCAGCAGG + Intronic
1142115849 16:88355759-88355781 AGCTCTGCAGAACTGTGAGCGGG + Intergenic
1142523746 17:523158-523180 AGCAGAGCAGGGCAGTCAGCAGG - Intronic
1142811069 17:2395748-2395770 GGTGGAGCAGAGCTGTCAGAGGG + Intronic
1142980238 17:3667386-3667408 AGCTTAGGACAGCTGTCAGCTGG + Intronic
1143330624 17:6132381-6132403 AGGGCAGTAGAGCTGACATCTGG + Intergenic
1144956443 17:19021172-19021194 GGCCCAGCAGAGCTCTCAGGAGG - Exonic
1145368453 17:22286527-22286549 AGCCCATCAGCGCTGGCAGCCGG + Intergenic
1146061424 17:29609437-29609459 AGTGCAGCTGGGCTGGCAGCTGG - Intronic
1150612105 17:66741748-66741770 AGCTCAGCAGAGAGGTTAGCTGG + Intronic
1150728731 17:67672963-67672985 AGCACAACACAGCTGTCGGCTGG - Intronic
1152005493 17:77677804-77677826 AGTGCAGCAGAGCAGGCAGCGGG - Intergenic
1152181427 17:78824153-78824175 AGCGCACCAGAGGTGCCAACTGG + Intronic
1152427964 17:80228898-80228920 GGAGGAGCAGGGCTGTCAGCAGG + Intronic
1152534376 17:80941826-80941848 AGCAGAGCAGAGGTGTGAGCCGG - Intronic
1154015849 18:10616473-10616495 TTCCCAGCAGAGCTGTCATCTGG - Intergenic
1155066697 18:22274385-22274407 AGAGCTGCAGGGCTGACAGCCGG - Intergenic
1155416402 18:25604469-25604491 AGGGCAGCACAGTTGTCAGCAGG + Intergenic
1157830252 18:50850934-50850956 AGAGCAGGAGAGCAATCAGCTGG + Intergenic
1159990937 18:74906403-74906425 AGAGCAGCACAGCTGACAGTTGG - Intronic
1160094196 18:75856227-75856249 AGGACAGCAGAGCTGTGAGTTGG + Intergenic
1160347357 18:78144824-78144846 AGAGCAGGAGAGCACTCAGCCGG + Intergenic
1160428347 18:78793671-78793693 ATCGCAGCAGAGATGACTGCCGG + Intergenic
1160429958 18:78804386-78804408 TGCTCAGCAGAGCTGGCAGGAGG - Intergenic
1160753851 19:747717-747739 AGCCCAGTAGAGCTGGCAGGTGG - Exonic
1161460656 19:4394994-4395016 CGCCCATCAGCGCTGTCAGCCGG - Intronic
1162015885 19:7846329-7846351 GGGGCAGCATGGCTGTCAGCTGG + Intronic
1162480721 19:10925498-10925520 AGAGCAGCAGAGCAGACAGGAGG - Intronic
1164990049 19:32676431-32676453 CGCGCAGCACAGCAGTCAGCCGG - Exonic
925254012 2:2466795-2466817 AGGGCAGCAGGTATGTCAGCGGG - Intergenic
925454164 2:4000197-4000219 AGCGAAGCAGAGCTGAGAACAGG - Intergenic
926162586 2:10499339-10499361 AGCCCAGGAGAACTGTGAGCTGG + Intergenic
926435759 2:12835986-12836008 ACCTCAGCATAGCTGTTAGCTGG - Intergenic
926916252 2:17894776-17894798 AGCCCAGCAGTGATGTTAGCCGG - Intronic
927678477 2:25124143-25124165 AGCCCAGCACAGCTGCCACCGGG - Intronic
928063156 2:28135539-28135561 AGAGAAGCAGATCTGTAAGCAGG - Intronic
928489521 2:31767081-31767103 AGTGGAGGAGAGCTGTCAGGGGG - Intergenic
929077673 2:38092000-38092022 AGTGCTGCAGAGCTGCCATCTGG - Intronic
932844528 2:75121889-75121911 AGAGTAGCAGAGCTGTCAGCTGG + Intronic
935331327 2:101979814-101979836 AGGGGAGCAGAACTGTGAGCAGG + Intergenic
935584737 2:104790423-104790445 AGCGCAGCTGAGCTGACGGCGGG + Intergenic
939007969 2:136810946-136810968 AATGCAGCACAGCTCTCAGCAGG - Intronic
942464250 2:176190385-176190407 AGCGGAGCTGGGCTGGCAGCTGG - Exonic
943624168 2:190180607-190180629 AGCGGAGCTGGGCTGCCAGCCGG - Intronic
945056954 2:205877690-205877712 AGCCCAGCACAGGTGTGAGCTGG + Intergenic
947929333 2:233950610-233950632 AGCCCAGCAGGGAGGTCAGCAGG - Intronic
948678174 2:239611341-239611363 AGCGCAGTGGAGCTGACAGGTGG + Intergenic
948876817 2:240833862-240833884 ACCTCAGCAGTGGTGTCAGCAGG + Intergenic
948928776 2:241117046-241117068 AGCGCACCTGAGCTGTGAGGAGG + Intronic
1175718500 20:61271456-61271478 AGCACAGCAGAGAGGACAGCGGG + Intronic
1175743454 20:61436613-61436635 AGCTCAGCAGAGCTTTGTGCTGG - Intronic
1176257968 20:64162547-64162569 AGCGAAGCGGAGGTGGCAGCAGG - Intronic
1176281771 20:64317315-64317337 GGCGAAGCAGAGCTGTCTGGGGG - Intergenic
1182699460 22:32223624-32223646 TTCACAGCAGAGCTGTCATCTGG - Intronic
1182771792 22:32801697-32801719 AGCGGCGCAGAGCGGGCAGCAGG + Exonic
1183239537 22:36646991-36647013 AGCCCTCCAGAGCTGTGAGCTGG - Intronic
1183280723 22:36930644-36930666 AGCACAGCAGAGCTGAGGGCAGG - Intronic
1184256556 22:43290368-43290390 AGGGCAGCAGAGCTGTGAGGTGG - Intronic
1184389797 22:44196804-44196826 AGCGCAGCCCAGCCGTCTGCAGG + Intronic
1185046993 22:48533500-48533522 TGCCCATCAGAGATGTCAGCAGG + Intronic
1185233285 22:49695341-49695363 TGCCCAGCAAAGCTCTCAGCTGG - Intergenic
1185250355 22:49798626-49798648 AGCGCAGCAGCACCGTCAGCGGG + Exonic
950465163 3:13149199-13149221 AGCACAGCAGGGCTGTGAGGTGG + Intergenic
950888553 3:16382490-16382512 AGTGGAGGAGAGCTGGCAGCCGG - Intronic
959221763 3:103530451-103530473 AGAGCAGCAGAGCAGACAGGAGG - Intergenic
960054554 3:113267930-113267952 GTCCTAGCAGAGCTGTCAGCAGG - Intronic
960639913 3:119814781-119814803 TGCGGGGCAGAGCTGTCTGCTGG + Intronic
964337021 3:155665678-155665700 ACCAGAGCAGAGCTGTGAGCCGG + Intronic
968730939 4:2268916-2268938 CGTGCAGCACAGCTGTCCGCTGG + Intergenic
968835851 4:2963795-2963817 AGCGCGGCAGCGGTGACAGCTGG + Exonic
970172656 4:13305090-13305112 AGTGCAGCAGAGCTGAAAGCAGG - Intergenic
977860240 4:101949088-101949110 ATCCCAGCTGACCTGTCAGCTGG - Intronic
979602318 4:122599984-122600006 GGCTCAGCAGAGATTTCAGCTGG - Intergenic
984402713 4:179287413-179287435 AGCACAGAAGAGCTGTGATCTGG + Intergenic
985017931 4:185656839-185656861 ATCCCAGGAGAGCTCTCAGCAGG + Intronic
985660906 5:1156043-1156065 ACCGCTGCCGAGGTGTCAGCCGG - Intergenic
985958594 5:3282657-3282679 AGTGCGGCAGAGGTGTCAGAGGG + Intergenic
986397824 5:7347640-7347662 AGCACAGCAGAGCTGCCAGAGGG - Intergenic
989812349 5:45694851-45694873 AGGACAGGAAAGCTGTCAGCAGG - Intronic
991259076 5:64647529-64647551 AGCTCTGCAGAGCAGACAGCAGG - Intergenic
992582193 5:78191418-78191440 AGCTCAGTAGAGCTTTCAGCAGG + Intronic
997355533 5:133260500-133260522 GGAGCAGCAGAGCTGACGGCTGG - Intronic
997509528 5:134444208-134444230 AGCAGAGCACTGCTGTCAGCTGG + Intergenic
999319508 5:150604801-150604823 AAGCCAGCAGAGCTATCAGCAGG - Intronic
999487453 5:152012657-152012679 AGGCCCTCAGAGCTGTCAGCAGG + Intergenic
999758035 5:154679833-154679855 GGCAAGGCAGAGCTGTCAGCAGG - Intergenic
1001251625 5:170151482-170151504 GGCGCAGCAGATCTGGCAGGGGG - Intergenic
1001600905 5:172927558-172927580 AGCACAGCAGAGCTGCAAGATGG - Intronic
1003901782 6:10661260-10661282 AACGCAGCTGAGCTATCAGTAGG + Intergenic
1004499893 6:16199995-16200017 AGTGCAGCAGAGCAGCCAGCTGG - Intergenic
1005245128 6:23875231-23875253 AAAGCAGCAGAGCTGTCAACTGG + Intergenic
1006379815 6:33690991-33691013 GGGCCAGCAGGGCTGTCAGCAGG - Exonic
1006985856 6:38175131-38175153 AGAGCAGCAGAGCAGCCAGAAGG - Exonic
1009712727 6:67346471-67346493 AGAGCAGCAAAGCTGCCAGCAGG - Intergenic
1013320189 6:108980528-108980550 AGAGCAGCAGATCTCCCAGCAGG - Intergenic
1015485877 6:133769054-133769076 CACGCAGCAAAGCTGGCAGCTGG + Intergenic
1018093242 6:160363246-160363268 AGCGGAGCAGAGGTCGCAGCTGG + Intronic
1018741099 6:166729188-166729210 TGGGCAGCAGAGGTGACAGCTGG - Intronic
1018762558 6:166904519-166904541 AGCTCAGAAGTGCTGACAGCAGG + Intronic
1019453501 7:1112357-1112379 AGGGCAGGTGAGCTGTTAGCTGG - Intronic
1019670681 7:2276470-2276492 AGCACAGCAGAGCAGACGGCAGG + Intronic
1020124600 7:5526516-5526538 AGCTAACCAGAGCTGTCTGCAGG + Intergenic
1021781812 7:24114000-24114022 AGGGCAGCAGAGAGGGCAGCTGG - Intergenic
1022123962 7:27338039-27338061 AAAGCCCCAGAGCTGTCAGCAGG - Intergenic
1024640550 7:51325274-51325296 AACACAGGAGAGGTGTCAGCTGG - Intergenic
1026469426 7:70682167-70682189 ATCACAGAAGAGCTGTCAGATGG + Intronic
1028121394 7:87059640-87059662 AGCGCAGCAGAGCTGTCAGCGGG - Exonic
1035567242 8:649812-649834 AGAGCAGGTGAGCTGACAGCTGG + Intronic
1036788530 8:11703328-11703350 AGCGCAGCGGGGCTGCGAGCCGG - Intronic
1037779582 8:21858535-21858557 AGCACAGCACTGCTGTGAGCTGG + Intergenic
1037910523 8:22741211-22741233 AGCTCAGCAGAGATGGCAGCTGG - Intronic
1038415875 8:27395566-27395588 AGAGGTGCAGAGCTGGCAGCAGG - Intronic
1042906161 8:73774165-73774187 AGCGAAGCAGAGCTGGGAACGGG + Intronic
1043136274 8:76530037-76530059 AGCTCTGCAGAGCTGTGAGATGG + Intergenic
1047338708 8:123959456-123959478 AGCACTGCAGAGCTGCCAGAAGG - Intronic
1049289268 8:141792810-141792832 AGTGGAGCAGAGCTTACAGCTGG - Intergenic
1049396696 8:142404158-142404180 AGCTCAGCAAGGCTGTCCGCGGG - Intergenic
1049509781 8:143021756-143021778 ACCGCAGCAGGGCCGGCAGCAGG - Exonic
1049733803 8:144192691-144192713 AGCGCAGCTGAAGTGCCAGCTGG + Intronic
1051574182 9:18595858-18595880 GGCAGAGCAGATCTGTCAGCTGG + Intronic
1057544359 9:96006388-96006410 ACAGCAGCAGAGCACTCAGCAGG + Intronic
1059219491 9:112600332-112600354 AGCACAGCAGGGCTGTCCTCAGG + Intronic
1060766427 9:126297708-126297730 AGGGCAACAGAGCTGGCTGCTGG + Intergenic
1061411658 9:130425226-130425248 AGCCCTGCAGCGCTGTCAGAAGG - Intronic
1062544710 9:137056201-137056223 AGGGCAGCCAAGATGTCAGCAGG - Intergenic
1185691822 X:2161714-2161736 AGCTCTGCAGAGCTGTGTGCTGG + Intergenic
1186509574 X:10120727-10120749 AGCATAGCAGAGCTGCCAGGTGG - Intronic
1188164278 X:26842879-26842901 AGTGCAGCAGGGTTGGCAGCTGG - Intergenic
1189287573 X:39862473-39862495 AGCGATGCAGAAGTGTCAGCAGG - Intergenic
1190642720 X:52495835-52495857 AACGCGGCGGAGCTGTGAGCCGG + Exonic
1190644953 X:52517032-52517054 AACGCGGCGGAGCTGTGAGCCGG - Exonic
1197970925 X:132114157-132114179 TGCCCAGCAGGGCTGTGAGCAGG + Intronic
1198751698 X:139942550-139942572 AGCTTAGGAGGGCTGTCAGCAGG + Intronic
1198933166 X:141880821-141880843 AGAGAAGAAGAGCTGTAAGCCGG + Intronic
1198936365 X:141905033-141905055 AGAGAAGAAGAGCTGTAAGCCGG + Exonic
1199979480 X:152913130-152913152 AGCTCAGCACTGCTGCCAGCTGG - Intergenic