ID: 1028121395

View in Genome Browser
Species Human (GRCh38)
Location 7:87059641-87059663
Sequence GAGCGCAGCAGAGCTGTCAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 193}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028121395_1028121402 17 Left 1028121395 7:87059641-87059663 CCGCTGACAGCTCTGCTGCGCTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1028121402 7:87059681-87059703 CGCCGATGCTCCCGTCACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 29
1028121395_1028121407 25 Left 1028121395 7:87059641-87059663 CCGCTGACAGCTCTGCTGCGCTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1028121407 7:87059689-87059711 CTCCCGTCACGCCGGAGGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1028121395_1028121404 20 Left 1028121395 7:87059641-87059663 CCGCTGACAGCTCTGCTGCGCTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1028121404 7:87059684-87059706 CGATGCTCCCGTCACGCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1028121395_1028121405 21 Left 1028121395 7:87059641-87059663 CCGCTGACAGCTCTGCTGCGCTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1028121405 7:87059685-87059707 GATGCTCCCGTCACGCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1028121395_1028121406 24 Left 1028121395 7:87059641-87059663 CCGCTGACAGCTCTGCTGCGCTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028121395 Original CRISPR GAGCGCAGCAGAGCTGTCAG CGG (reversed) Exonic
900161913 1:1227899-1227921 GAGCAGAGCTGTGCTGTCAGTGG - Intronic
901177315 1:7313907-7313929 GGGCACATCAGAGCTCTCAGAGG + Intronic
901312768 1:8282304-8282326 CAGCTCGGCAGAGCTGTCTGTGG - Intergenic
901752095 1:11416595-11416617 GAGCACAGCAGTACTGCCAGAGG - Intergenic
902718838 1:18290937-18290959 GAGCCCAGCTGAGCTGCGAGAGG + Intronic
904548606 1:31296778-31296800 GAGAGCGGCAGCGCGGTCAGTGG - Intronic
905122230 1:35691003-35691025 GAAAGCTGCAGAGGTGTCAGAGG + Intergenic
905866175 1:41377914-41377936 GAGCCCAGCTCAGCAGTCAGAGG + Intronic
907983572 1:59508542-59508564 GAGGGCACTAGAGCTGTCAGAGG - Intronic
913263970 1:117026392-117026414 CAGCGCAGCAGGGCTTCCAGAGG + Intronic
915440880 1:155944830-155944852 GAGCCCAGCAAAGCCATCAGAGG - Intergenic
918851237 1:189693240-189693262 GAGCTCAGCTGAACTGTGAGAGG - Intergenic
920099114 1:203505839-203505861 CAGAGCAGCAGAGCTGTCACTGG + Intronic
921357892 1:214303802-214303824 CAGCCCAGCAGAGCTGACGGGGG - Intronic
924169535 1:241323671-241323693 GAGAGAAGCAGAGCTGCCAACGG + Intronic
1067190455 10:44063801-44063823 GACTCCAGCTGAGCTGTCAGAGG - Intergenic
1067348312 10:45454161-45454183 CAGCGTGGCAGAGCTGTCACTGG + Intergenic
1067943839 10:50678342-50678364 GTGAGCAGCAGGGCTATCAGGGG - Intergenic
1069172777 10:65254416-65254438 GAGGGCAGCAGCGGTGGCAGTGG - Intergenic
1070865329 10:79705211-79705233 GCGAGCAGCAGAGCTAACAGGGG - Intronic
1070879122 10:79843342-79843364 GTGAGCAGCAGAGCTAACAGGGG - Intronic
1071632229 10:87227432-87227454 GCGAGCAGCAGAGCTAACAGGGG - Intronic
1071645682 10:87359651-87359673 GCGAGCAGCAGAGCTAACAGGGG - Intronic
1074503420 10:114045293-114045315 GCGCGCAGCAGAGCAGTCCCTGG - Exonic
1074721998 10:116272117-116272139 CAGAGCAGCACAGCTGTCCGGGG - Exonic
1075713712 10:124544122-124544144 GAGCCCAGCAGAGCTGGAGGGGG + Intronic
1076143650 10:128099006-128099028 GAGCCCAGCAGTGCTCCCAGTGG + Exonic
1081594098 11:44447259-44447281 GAGCTCTGCACAGCTGTCAGAGG + Intergenic
1082786241 11:57318589-57318611 GAGCCCAGCAGAGCTGTTAAAGG + Intronic
1083583508 11:63839791-63839813 GAGCGCAGGAGGGCGGTGAGGGG - Intronic
1083855926 11:65393103-65393125 GAGCTCCTCAGAGGTGTCAGAGG + Intronic
1084268332 11:68016343-68016365 GAGGCCAGCATAGCTGTCGGGGG + Intronic
1084447428 11:69212060-69212082 GGGGGCAGCAGAGCCGTCACTGG - Intergenic
1086290584 11:85304748-85304770 AAGGGCAGTAAAGCTGTCAGGGG + Intronic
1086541238 11:87915188-87915210 GTGCCTAGCAAAGCTGTCAGAGG + Intergenic
1090399943 11:126442740-126442762 GAGCGCACCAGACCTGCCAGGGG - Intronic
1090442146 11:126733254-126733276 GAGCTCAGCAGATGTCTCAGAGG + Intronic
1091383406 12:77471-77493 TGGCGAAGCAGAGCTGTCTGGGG + Intronic
1092677600 12:10939403-10939425 AAGCTCAGCTGAGCTGTCTGGGG - Intronic
1092965181 12:13634532-13634554 GAGCGTAGTTGAGCTGTCAGGGG + Intronic
1095920581 12:47526113-47526135 GAGAGCAGCTGACCTGTCAAGGG - Intergenic
1098095612 12:66952183-66952205 CAGCTGAGCAGAGCAGTCAGAGG + Intergenic
1103704323 12:122863101-122863123 AAGCTCAGCAGGGCTGTCACTGG + Intergenic
1106641322 13:31587212-31587234 GTGCCCAGCAAAGCTGTGAGGGG + Intergenic
1111596297 13:90415881-90415903 GAGCTCAGCAGTCCTGTGAGAGG - Intergenic
1112013290 13:95309813-95309835 GAGAAGAGCAGAGCTTTCAGTGG + Intergenic
1113044212 13:106137205-106137227 GAGAAGAGCAGAGCTTTCAGTGG - Intergenic
1113120351 13:106917916-106917938 GCGCGCAGCAGAAACGTCAGGGG - Intergenic
1113460797 13:110480452-110480474 GCGCCCAGCAGAGCTGTCTCAGG - Intronic
1113816587 13:113175913-113175935 GAGCTCAGCAGGGCTGTGGGTGG - Intergenic
1114576981 14:23724562-23724584 GAGAGCAGTAGTGATGTCAGAGG + Intergenic
1120951499 14:90046042-90046064 GGGCACAGCACTGCTGTCAGGGG - Intergenic
1121640139 14:95479806-95479828 GAGGGCACCAGAGCTGGCAAGGG + Intergenic
1121735495 14:96214927-96214949 GAATGCATCAGAGCTGCCAGGGG + Intronic
1121792350 14:96708854-96708876 TAGCGCAGCAGTGGTGGCAGTGG + Intergenic
1122723503 14:103735536-103735558 GTGCCCTGCAGAGCTGCCAGGGG - Intronic
1124216665 15:27813044-27813066 GAGAGCAGCACAGGTGTCAAGGG + Intronic
1124607331 15:31179486-31179508 GAGCCCAGCAGAACTGGCCGGGG + Intergenic
1125588604 15:40840114-40840136 GAGAGTGTCAGAGCTGTCAGAGG - Intergenic
1129664622 15:77572637-77572659 GAGAGCAGCAGGGGTGTCGGGGG - Intergenic
1130416673 15:83701038-83701060 TGGAGCAGCAGAGGTGTCAGAGG + Intronic
1131305932 15:91243230-91243252 GTGCCCAGGAGAGCTATCAGAGG + Intronic
1133225625 16:4339023-4339045 GGGGTCAGCAGAGCTGCCAGAGG - Exonic
1133430545 16:5733463-5733485 CCGAGCAGCAGTGCTGTCAGTGG + Intergenic
1134114158 16:11535719-11535741 GAGCTCAGCTGAGCTGCAAGAGG + Intergenic
1139204417 16:65013345-65013367 GACAGGAGCCGAGCTGTCAGAGG + Intronic
1139549377 16:67665042-67665064 GAGCGCCACAGAGCTTTCAGGGG + Exonic
1141423427 16:83931379-83931401 GGGTGCAGCAGAGGTGACAGAGG - Intronic
1141611530 16:85183809-85183831 GGGAGCAGCAGAGCTGACATGGG + Intronic
1142185879 16:88694532-88694554 GTGCCCAGGAGGGCTGTCAGAGG - Intergenic
1142374012 16:89697616-89697638 GGCCGCTGCAGAGCTTTCAGGGG + Exonic
1142567426 17:849729-849751 GAGTGCTGAAGAGCTGACAGTGG + Intronic
1142577987 17:921858-921880 GAGCCCAGAAGAGATGCCAGTGG - Intronic
1142811068 17:2395747-2395769 AGGTGGAGCAGAGCTGTCAGAGG + Intronic
1143699868 17:8650406-8650428 GAGGGCAGGAGAGCTCTCTGGGG + Intergenic
1146664254 17:34686531-34686553 GAGGGCAGGAGAACTCTCAGGGG - Intergenic
1147805217 17:43126388-43126410 GATAGCGGCAGAGCTGGCAGCGG + Intergenic
1148321327 17:46756271-46756293 TAGCTCAGGACAGCTGTCAGAGG - Exonic
1150317985 17:64186009-64186031 CAGCCCAGCATTGCTGTCAGGGG - Intronic
1150413342 17:64965805-64965827 GACGGCAGCAGAGCAGTGAGTGG - Intergenic
1150798475 17:68259412-68259434 GACGGCAGCAGAGCAGTGAGTGG + Exonic
1152005494 17:77677805-77677827 CAGTGCAGCAGAGCAGGCAGCGG - Intergenic
1152646143 17:81469375-81469397 GACCACAGCACAGCTGCCAGGGG + Intergenic
1153477143 18:5509360-5509382 TAGCTCATCAGAGGTGTCAGCGG + Intronic
1153565067 18:6410980-6411002 GAGCCCATCAGAGTTGTCACAGG - Intronic
1153615375 18:6929226-6929248 GAGCTCAGCATAGCTGACACAGG - Intergenic
1153935017 18:9913855-9913877 GAGCGCAGCCCAGCTGTCAAGGG - Intergenic
1155289379 18:24325326-24325348 GATAGCATCAGAGCTGCCAGAGG - Intronic
1157414569 18:47491094-47491116 GAGCTCAGCTGAGCTGGGAGAGG - Intergenic
1158579999 18:58672160-58672182 GAGAGAAGGAAAGCTGTCAGGGG + Intronic
1159450595 18:68597245-68597267 GAGGGCAAGAGAGCTCTCAGGGG - Intergenic
1160843253 19:1155752-1155774 GGGCCCAGCAGAGCTGTTTGTGG - Intronic
1161009590 19:1953870-1953892 GAACGCAGCTGAGCCGTCACAGG - Intronic
1161685247 19:5699339-5699361 GAGCACATCAGAGCTGCCACTGG + Intronic
1162447226 19:10730944-10730966 GAGGCCAGCAGAGCTGTCCCAGG + Intronic
1163260359 19:16185849-16185871 GAGGGCAGGGGAGCGGTCAGAGG + Intronic
1163698143 19:18774310-18774332 GAGGCCAGCAGGGCTCTCAGAGG - Intronic
1164414962 19:28039390-28039412 GAGAGGAGCAGGGCTGCCAGTGG - Intergenic
1164686184 19:30168252-30168274 GAGGGCACCAGAGATGCCAGGGG - Intergenic
1165092971 19:33396296-33396318 GAGGGGAGCAAAGCTGGCAGAGG + Intronic
928489522 2:31767082-31767104 AAGTGGAGGAGAGCTGTCAGGGG - Intergenic
932494525 2:72139854-72139876 GAGCCCATCAGGGCTGGCAGAGG - Intronic
935584736 2:104790422-104790444 GAGCGCAGCTGAGCTGACGGCGG + Intergenic
935829675 2:106988007-106988029 GATAGCAGCAGAGATGTCAGGGG + Intergenic
936155242 2:110042782-110042804 AAGAGAAGCAGAGCTGACAGGGG - Intergenic
941232691 2:162931097-162931119 GAGAGCAGCACAGAGGTCAGTGG - Intergenic
941695235 2:168544351-168544373 GAGAGGACCAGAGATGTCAGTGG - Intronic
941842528 2:170102094-170102116 GAACACAGCAGAGATGCCAGAGG + Intergenic
944053718 2:195500763-195500785 GAGTGCAGCTGAGCAGTCAGCGG + Intergenic
945852674 2:215028358-215028380 GAGCACAGCAAAGTGGTCAGAGG + Intronic
948227143 2:236320100-236320122 GAGTGCAGCAGAATTGTTAGGGG + Intergenic
948784584 2:240345746-240345768 GGGTGCTGCAAAGCTGTCAGAGG - Intergenic
1174516741 20:51098394-51098416 TAGCACAGCAGATCTGACAGGGG - Intergenic
1175256818 20:57652712-57652734 GAGGGCAGCAGGGCTGGCGGGGG + Intronic
1175835996 20:61994814-61994836 GAGCGAAACAGAGAAGTCAGGGG + Intronic
1176281772 20:64317316-64317338 TGGCGAAGCAGAGCTGTCTGGGG - Intergenic
1177774191 21:25549958-25549980 GAGAGAGACAGAGCTGTCAGGGG + Intergenic
1178224787 21:30703280-30703302 AAGCTGAGCAGAGCTTTCAGTGG + Intergenic
1178434724 21:32547884-32547906 GAGCAATGCAGAGCTGTGAGAGG - Intergenic
1178934869 21:36852632-36852654 GAGCCCAGCACACCTCTCAGAGG + Intronic
1179291093 21:40019043-40019065 GAGAGCACCAGAGTAGTCAGCGG + Intronic
1179396389 21:41044008-41044030 GGGCTCAGCAGAGCTGCCTGAGG - Intergenic
1179909000 21:44438206-44438228 GAGCGCAGCAGGGCAGCAAGGGG - Intronic
1180007554 21:45029944-45029966 GAGTGGAGCAGAGCTGGCCGTGG + Intergenic
1182806884 22:33079922-33079944 GAGCACAAGAGAGCTATCAGGGG + Intergenic
1183828970 22:40408106-40408128 GAGCGCAGCAAAGAGGTGAGGGG + Exonic
1184014132 22:41772848-41772870 GAGCTCAGGAGAGAGGTCAGGGG - Intronic
1184115147 22:42417815-42417837 GAGGGCAGCAGGGCCATCAGAGG + Intronic
1185250354 22:49798625-49798647 GAGCGCAGCAGCACCGTCAGCGG + Exonic
950471386 3:13188788-13188810 GAGGGAAGCAGAGCTGAGAGAGG + Intergenic
950912448 3:16608628-16608650 GAGCACAGAAGAACTGGCAGAGG - Intronic
951049802 3:18081551-18081573 GAGCTGGACAGAGCTGTCAGGGG + Intronic
952037534 3:29220968-29220990 GAGCTGAGCAGCGCTGTGAGTGG - Intergenic
955014997 3:55061649-55061671 GAGCACAGGAAAGCTGCCAGTGG + Intronic
957592843 3:82223589-82223611 GCTAGCAGCAGACCTGTCAGCGG - Intergenic
961645976 3:128392987-128393009 GAGCCCAGCCTTGCTGTCAGAGG + Intronic
962682684 3:137816015-137816037 GAGGGCAGCAGGGGTGCCAGAGG - Intergenic
963271358 3:143289097-143289119 GATGACAGCTGAGCTGTCAGTGG + Intronic
966237596 3:177719675-177719697 GAAATCAGCAGAGCTGTCAATGG + Intergenic
967902964 3:194476122-194476144 CAGCTCAGCAGAGTTGTAAGAGG - Intronic
968497491 4:926838-926860 GAGCGCAGGTGAGCTGGGAGGGG - Intronic
969389898 4:6884797-6884819 GACAGCAGCAGAGCTTTCAGGGG - Intergenic
971120381 4:23697857-23697879 GAGGGGAGAAGAGCTGTCATGGG - Intergenic
971236894 4:24850438-24850460 GAGAGGAGCAGAGCTTGCAGGGG + Intronic
971399182 4:26259583-26259605 GACAACAGCAGAGCTTTCAGTGG - Intronic
971806520 4:31365354-31365376 GGGTGCAGCAGGGCTCTCAGAGG - Intergenic
975869816 4:78767440-78767462 GAGCTCAGAAAAGCTCTCAGAGG + Intergenic
976948948 4:90805365-90805387 GAGCTCAGTGAAGCTGTCAGTGG + Intronic
978964957 4:114729441-114729463 GACTGCTGCAGAGCTGGCAGAGG + Intergenic
985497270 5:216416-216438 GAGAGCAGCAAAGCCTTCAGAGG + Intronic
985727510 5:1523864-1523886 GAGCGCAGCCGAGCTGCCTGGGG + Exonic
985738310 5:1598540-1598562 GAGAGCAGCAAAGCCTTCAGAGG - Intergenic
985870095 5:2547707-2547729 GAGAGGACCAGAGCTGTCGGTGG - Intergenic
985958593 5:3282656-3282678 GAGTGCGGCAGAGGTGTCAGAGG + Intergenic
985968608 5:3356965-3356987 GAGTGGAGCAGCCCTGTCAGAGG + Intergenic
986327505 5:6687280-6687302 CAGCGCTGCACAGCTGTGAGGGG + Intergenic
986397825 5:7347641-7347663 AAGCACAGCAGAGCTGCCAGAGG - Intergenic
986740093 5:10698463-10698485 GAGCGCAGCAGGGCAGGCTGTGG + Intronic
995180548 5:109226712-109226734 GAGAGCAGCACAGCTCACAGTGG + Intergenic
996245209 5:121255041-121255063 GAGAGCAACAGAGCTCTCTGTGG - Intergenic
1001251626 5:170151483-170151505 GGGCGCAGCAGATCTGGCAGGGG - Intergenic
1004555759 6:16696081-16696103 GAGCCCAGGAGAGCTGTCCAGGG - Intronic
1005659219 6:27977505-27977527 GACTGCAGCATAGCTGTCATAGG - Intergenic
1006101476 6:31688663-31688685 GCGCCCAGCAGAGCTGTATGGGG + Intronic
1006271071 6:32968274-32968296 GCACGCTGCTGAGCTGTCAGCGG - Intronic
1010620056 6:78062841-78062863 GAATGCAGCAGGGCAGTCAGTGG + Intergenic
1018340455 6:162846131-162846153 GAGCTGGGCAGGGCTGTCAGGGG + Intronic
1019093822 6:169562962-169562984 GAGCACAGCAGCGCTGCCGGGGG + Intronic
1019597613 7:1865426-1865448 GCCCACAGCAGAGCTTTCAGAGG + Intronic
1022184073 7:27949843-27949865 GAGGCTAGCAGAGCTGTGAGAGG - Intronic
1025789777 7:64679021-64679043 GAGAGCAGCAGAGATGAAAGAGG + Intronic
1027177695 7:75915158-75915180 GAGAGCAGCCGGGCTGCCAGCGG + Exonic
1028121395 7:87059641-87059663 GAGCGCAGCAGAGCTGTCAGCGG - Exonic
1028362210 7:89982457-89982479 GTGCGCTGCAGAGCAGTCAAGGG - Intergenic
1030018002 7:105244064-105244086 GAGGGCTGAAGAGCTGGCAGGGG + Intronic
1035458980 7:159027839-159027861 GGGCTCTGCAGAGCTGACAGAGG + Intergenic
1035735662 8:1885710-1885732 GAGATGAGCAGAGCTGACAGGGG + Intronic
1036488549 8:9202158-9202180 GAGGGCAGCAGGCCTGTAAGAGG - Intergenic
1036652391 8:10653731-10653753 GAGAGCAGCAGGCCTGTCTGAGG + Intronic
1036782324 8:11658265-11658287 GAGGGCAGCACAGCAGCCAGTGG + Intergenic
1037191699 8:16133803-16133825 GACAACAGCAGAGCTTTCAGTGG - Intronic
1040565791 8:48565554-48565576 GAGCACAGCAGGGCAGTGAGTGG + Intergenic
1041193634 8:55378304-55378326 GAGCCAAAGAGAGCTGTCAGTGG + Intronic
1041770101 8:61464035-61464057 GAGTGCAGTAGTGCAGTCAGTGG - Intronic
1043443994 8:80301392-80301414 GAGCTCATCAGTGCTGTCAAGGG + Intergenic
1047893606 8:129340683-129340705 GAGGGCAGCAGATCTTACAGAGG - Intergenic
1049396697 8:142404159-142404181 GAGCTCAGCAAGGCTGTCCGCGG - Intergenic
1049717894 8:144101970-144101992 GAGATAAGCAGAGCTGCCAGAGG - Intronic
1050069278 9:1793361-1793383 GAGTGCAGTAGATCTTTCAGAGG - Intergenic
1051213262 9:14768162-14768184 GAGCGCAGTGTAGCTGACAGAGG - Intronic
1051303622 9:15682251-15682273 TACAGCAGCAGAGCTGTTAGAGG + Intronic
1052355771 9:27503529-27503551 GAGCGCAGGAGAGCTGACTGAGG - Intronic
1056550227 9:87646911-87646933 GACGTCAGCAGAGCTGTAAGTGG + Intronic
1057229935 9:93315190-93315212 GAGAAGAGCAGAGCTGTCAGTGG - Intronic
1057355328 9:94327057-94327079 GTGAGCAGCAGGGCTATCAGGGG + Intronic
1057652427 9:96930566-96930588 GTGAGCAGCAGGGCTATCAGGGG - Intronic
1059408679 9:114118397-114118419 GAGGGCAGCTGAGCCGGCAGGGG - Intergenic
1059982709 9:119790785-119790807 GAGGGCAGCAGATGTTTCAGTGG - Intergenic
1059983440 9:119798221-119798243 GAGCCCAGCAGAGCAGCCAAGGG - Intergenic
1062039971 9:134400046-134400068 GGGGGCAGCAGAGCTGTGTGAGG + Intronic
1062255506 9:135618990-135619012 GAGGGCAGCAGAGGGGTGAGGGG - Intergenic
1062569720 9:137179494-137179516 GATCTCAGCAGTGCTGCCAGGGG + Intronic
1203454791 Un_GL000219v1:156228-156250 CAGCGCAGCAGAGCAGGAAGTGG + Intergenic
1187158610 X:16744228-16744250 GAGCCCAGAAGAGCTGTTGGAGG - Intronic
1189208432 X:39262106-39262128 GAGCCTAGTAGGGCTGTCAGTGG + Intergenic
1192925160 X:75748158-75748180 GTTAGCAGCAGAGCTGTGAGTGG - Intergenic
1193311189 X:80012633-80012655 GAGCACTGCAGAGCTCACAGAGG + Intergenic
1196410785 X:115416191-115416213 GTGAGAAGCAGAGCTGTCAGAGG - Intergenic
1196649793 X:118157151-118157173 GAGGGCAGCAGTGGTGTCATGGG - Intergenic
1197612160 X:128652034-128652056 GAGCTCAGCAGAGCCCTGAGTGG + Intergenic
1202282233 Y:23201791-23201813 GAGCACAGAAGAACTGGCAGAGG - Intergenic
1202283658 Y:23216728-23216750 GAGCACAGAAGAACTGGCAGAGG + Intergenic
1202433905 Y:24816176-24816198 GAGCACAGAAGAACTGGCAGAGG - Intergenic
1202435334 Y:24831114-24831136 GAGCACAGAAGAACTGGCAGAGG + Intergenic