ID: 1028121399

View in Genome Browser
Species Human (GRCh38)
Location 7:87059668-87059690
Sequence AGCATCGGCGCTGGCTGCCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 124}

Found 17 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028121399_1028121416 18 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121416 7:87059709-87059731 GGGACCGCGGGGCGCGGGCGCGG 0: 1
1: 2
2: 14
3: 119
4: 792
1028121399_1028121421 26 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121421 7:87059717-87059739 GGGGCGCGGGCGCGGCGCGGGGG 0: 1
1: 2
2: 38
3: 254
4: 1681
1028121399_1028121423 30 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121423 7:87059721-87059743 CGCGGGCGCGGCGCGGGGGCGGG 0: 1
1: 1
2: 21
3: 225
4: 1380
1028121399_1028121406 -3 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121399_1028121407 -2 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121407 7:87059689-87059711 CTCCCGTCACGCCGGAGGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1028121399_1028121414 12 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121414 7:87059703-87059725 GAGGGAGGGACCGCGGGGCGCGG 0: 1
1: 0
2: 9
3: 67
4: 813
1028121399_1028121412 7 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121412 7:87059698-87059720 CGCCGGAGGGAGGGACCGCGGGG 0: 1
1: 0
2: 1
3: 16
4: 176
1028121399_1028121422 29 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121422 7:87059720-87059742 GCGCGGGCGCGGCGCGGGGGCGG 0: 1
1: 1
2: 32
3: 243
4: 1540
1028121399_1028121404 -7 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121404 7:87059684-87059706 CGATGCTCCCGTCACGCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1028121399_1028121402 -10 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121402 7:87059681-87059703 CGCCGATGCTCCCGTCACGCCGG 0: 1
1: 0
2: 0
3: 3
4: 29
1028121399_1028121418 23 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121418 7:87059714-87059736 CGCGGGGCGCGGGCGCGGCGCGG 0: 1
1: 3
2: 44
3: 224
4: 1280
1028121399_1028121415 13 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121415 7:87059704-87059726 AGGGAGGGACCGCGGGGCGCGGG 0: 1
1: 1
2: 2
3: 45
4: 437
1028121399_1028121405 -6 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121405 7:87059685-87059707 GATGCTCCCGTCACGCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1028121399_1028121420 25 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121420 7:87059716-87059738 CGGGGCGCGGGCGCGGCGCGGGG 0: 1
1: 3
2: 30
3: 224
4: 1213
1028121399_1028121410 5 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121410 7:87059696-87059718 CACGCCGGAGGGAGGGACCGCGG 0: 1
1: 0
2: 1
3: 10
4: 166
1028121399_1028121419 24 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121419 7:87059715-87059737 GCGGGGCGCGGGCGCGGCGCGGG 0: 1
1: 12
2: 27
3: 245
4: 1345
1028121399_1028121411 6 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121411 7:87059697-87059719 ACGCCGGAGGGAGGGACCGCGGG 0: 1
1: 0
2: 2
3: 8
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028121399 Original CRISPR AGCATCGGCGCTGGCTGCCC GGG (reversed) Exonic
900209069 1:1444645-1444667 AGCCTCGGTCCTGGGTGCCCTGG + Intergenic
900218904 1:1496563-1496585 AGCCTCGGTCCTGGGTGCCCTGG + Intronic
900232854 1:1570521-1570543 GGCATTGGCGCTGAGTGCCCAGG - Intronic
900358951 1:2278791-2278813 CGCATGGGTGCTGCCTGCCCAGG - Intronic
900528876 1:3142937-3142959 AGCATCGCACCTGGGTGCCCCGG - Intronic
902215930 1:14934648-14934670 AGCAACGGGACAGGCTGCCCTGG + Intronic
902377172 1:16035274-16035296 AGCATCGGCGGCGGCTGCCCGGG - Intergenic
902382350 1:16058533-16058555 AGCATCGGCGGCGGCTGCCCGGG - Exonic
903141452 1:21341673-21341695 AGCAGGGGCACAGGCTGCCCAGG + Intronic
903749072 1:25608555-25608577 AGGATCCGCACTGGCTGCACCGG - Intergenic
905795163 1:40811864-40811886 AACATGGGTGCTGGCTGGCCTGG - Intronic
906960909 1:50419074-50419096 TGCAGCGGCGCAGGCAGCCCAGG + Exonic
912988505 1:114459168-114459190 AGGATGGGTGCTGGCTGCCAGGG + Intronic
915461173 1:156071360-156071382 AGCATAGGAGATGGCTGTCCAGG + Intergenic
915491370 1:156251785-156251807 TGCATCTGCTCTGGCTGGCCAGG - Intronic
920490495 1:206410884-206410906 AGCCTCGGCTCTTGTTGCCCAGG + Intronic
920595000 1:207259973-207259995 AGCACAAGCCCTGGCTGCCCTGG + Intergenic
920705609 1:208248424-208248446 GGCAACGGGGCTGGCAGCCCAGG + Intergenic
922226838 1:223652787-223652809 AGCCTCTGTGGTGGCTGCCCCGG - Intronic
924648501 1:245902291-245902313 AGCATGGGAGCTGCCTGCCTGGG + Intronic
1065329525 10:24580079-24580101 GGCATCTCAGCTGGCTGCCCAGG - Intergenic
1067053451 10:43038275-43038297 AGCTTCAGCCCTGCCTGCCCAGG - Intergenic
1075556403 10:123435584-123435606 AGCACCGGCCGTGGCTTCCCAGG - Intergenic
1075998746 10:126898436-126898458 AGCACTGGCTCTGGCTTCCCTGG + Intergenic
1076251384 10:128986489-128986511 AGCATTGCAGCTGGCTGCCAAGG - Intergenic
1076371007 10:129953669-129953691 AGCAGGGGCTGTGGCTGCCCAGG - Intronic
1076380778 10:130023401-130023423 AGCACCGGGGCTGGCTGTCCTGG + Intergenic
1078266638 11:9759795-9759817 AGCATAGGCGCTTGCTCCCCAGG - Intergenic
1081329291 11:41784681-41784703 AGAATGGGGGCTGGCTGCCAGGG + Intergenic
1081938112 11:46918528-46918550 AGCGTCGGCTCTGGCAGCACTGG - Exonic
1083430353 11:62611135-62611157 AGCAGTGGTGCTGGCTCCCCTGG - Exonic
1084358464 11:68654313-68654335 AGCATCTGCCCAGGCTGTCCAGG - Intergenic
1084546446 11:69817383-69817405 GGCATCGGCGGTGCCTGACCGGG + Intronic
1087672886 11:101128051-101128073 GGCAAAGGCGCTGGCAGCCCCGG + Exonic
1090645969 11:128766899-128766921 AGCATCGGTTCTGGCAGCCTGGG - Intronic
1091794162 12:3287859-3287881 ACCCTCGGCTCTGGTTGCCCTGG + Intergenic
1096472939 12:51890286-51890308 AGCAGCGGTGCAGGCTGCCCAGG - Intronic
1106246470 13:27954235-27954257 GGCTTCGGCGCTTGCGGCCCAGG + Intergenic
1113389709 13:109883711-109883733 AGCATTGGCCTTGGCTGCCTTGG - Intergenic
1119703093 14:76768390-76768412 AGCAACCGCACTGGCTGCCCTGG - Intronic
1120030065 14:79631343-79631365 AGCGTCTGCTCTGGCTGCGCTGG + Intronic
1121236018 14:92391764-92391786 AGCATGGCCGCTGGGTTCCCAGG - Intronic
1121315293 14:92957820-92957842 AGCACCTGCCCTGGCTTCCCTGG + Intronic
1124628780 15:31325941-31325963 AGCAGCGGCGCCGGCCGCCCTGG + Intergenic
1128655936 15:69462151-69462173 GGCATCAGGGCTGACTGCCCTGG + Intergenic
1131340866 15:91599302-91599324 AGCATCCACAGTGGCTGCCCAGG - Intergenic
1132312885 15:100870066-100870088 TGCCTCGGTGCTGGCTGGCCAGG - Intergenic
1132548368 16:543964-543986 CGCATGGCCGCAGGCTGCCCTGG - Intronic
1132549054 16:546886-546908 AGCACTGGCGCTGGCCGGCCGGG - Exonic
1133460928 16:5985562-5985584 AGCCTTGGAGCTGGCTGCCTGGG - Intergenic
1134414535 16:14032152-14032174 AGGATGGGGGCTGGCTGCCATGG + Intergenic
1137240237 16:46649736-46649758 ATCATCGGAGCTGCCTGCCACGG + Intergenic
1137774600 16:51044621-51044643 TGCATGGGCTCTGTCTGCCCTGG - Intergenic
1141627117 16:85267150-85267172 AGCAGCGGCGGTGGCTGCCTGGG + Intergenic
1141685088 16:85565603-85565625 AGCCTTGGCACTCGCTGCCCTGG - Intergenic
1142113640 16:88345170-88345192 AGCATCTGGCCTGGGTGCCCGGG - Intergenic
1143677315 17:8443986-8444008 AGCATAGGCGCTGGGTGACTTGG - Intronic
1143924680 17:10359174-10359196 AGGATGGGGGCTGGCTGCCAGGG + Intronic
1145246471 17:21273024-21273046 AGCATCGGGGAAGGCTGCCCTGG + Intergenic
1146581158 17:34040014-34040036 GGCGCCGGCGGTGGCTGCCCGGG - Intronic
1149570921 17:57671815-57671837 AGCAACGGCTCTGGCTGCTTAGG - Intronic
1152757326 17:82092460-82092482 AGCCTCGGGGCTGGCAGCCCTGG - Exonic
1153248382 18:3095835-3095857 AGCCTCTGCCCTTGCTGCCCTGG - Intronic
1156462380 18:37328350-37328372 AGGATAGGCGCTGGCAGCCGAGG + Intronic
1157712747 18:49861118-49861140 AGAAAAGGAGCTGGCTGCCCTGG - Intronic
1158936984 18:62373674-62373696 AGGGCCGGCACTGGCTGCCCTGG + Intronic
1160679353 19:405683-405705 AGCCTCCGCCCTGGGTGCCCTGG + Exonic
1162474577 19:10892357-10892379 AGCACCGGAGCTGGGTGTCCAGG - Intronic
1162801832 19:13115593-13115615 AGCATAGGAGCTGGCAGCCCTGG - Intronic
1163051010 19:14683507-14683529 ATCATTGGCTGTGGCTGCCCTGG + Intronic
1163138689 19:15332074-15332096 ACCAACGGCGCAGGCCGCCCCGG + Intronic
1164608788 19:29618426-29618448 AGCATTGGGGCTGGCTGGACTGG - Intergenic
1165167720 19:33868937-33868959 TGCAGCGACGCTGCCTGCCCGGG + Intergenic
1166838734 19:45683342-45683364 AGCAGTGGCCCTGGCTGCTCTGG - Exonic
1166901629 19:46068259-46068281 AACATCAGCTCTGTCTGCCCTGG - Intronic
1168240371 19:55086189-55086211 AGCGTCTGCGCTGGCTCACCAGG - Exonic
929841890 2:45475371-45475393 AGCATTGGCTCTGGCTGATCTGG - Intronic
930105113 2:47633169-47633191 AGCTTCTGCCCAGGCTGCCCTGG - Intergenic
933658306 2:84906527-84906549 GGCATCGGCGCGGAGTGCCCAGG - Exonic
941917512 2:170822277-170822299 AGCGTGGTCGCTGGCTGTCCTGG - Intronic
944461657 2:199955984-199956006 AGCCTCGGCGCTACCTGCCCAGG + Exonic
947549792 2:231037901-231037923 CGCGTCGTCGCTGGCCGCCCGGG + Exonic
1169053956 20:2604633-2604655 TGCATCTGGGCTGGCTGCCAGGG + Intronic
1170665572 20:18383088-18383110 AGCAGTGGCGGTGCCTGCCCAGG + Intergenic
1172180843 20:33002507-33002529 AGCCTCGGCCCAGGCTGACCTGG - Intronic
1180255072 21:46621320-46621342 AGCAACAGTGCTGCCTGCCCAGG + Intergenic
1180907844 22:19427727-19427749 AGCATAAGCGCTGTCTGCCCAGG + Intronic
1180994681 22:19959616-19959638 AGCAGAGGGACTGGCTGCCCCGG - Intronic
1181269525 22:21651086-21651108 AGCATGGGCTTTGGTTGCCCAGG - Intergenic
1182016694 22:27046338-27046360 TGCATCAGGGCTGCCTGCCCTGG + Intergenic
1182850248 22:33467778-33467800 AACAGAGGCGCTGGCTGCTCCGG + Intronic
1183312714 22:37119686-37119708 ACAATCAGCGATGGCTGCCCTGG + Intergenic
1184596221 22:45515827-45515849 AGAGGCGGCGCTGCCTGCCCAGG + Intronic
1184855895 22:47146552-47146574 GGCATCGGTGCCGGCTGCCTGGG - Intronic
950348911 3:12327583-12327605 AGCATCTGCGCCAGCTGCCTCGG - Intronic
954316601 3:49804818-49804840 AGCTTCGGCGCCGGCTGGCCAGG + Exonic
955848465 3:63193952-63193974 AGCATCAACTCTGGCTGGCCAGG + Intergenic
961565455 3:127760447-127760469 AGCATCGGGGCTGACTGCAGGGG - Intronic
963140919 3:141945524-141945546 ACCATATGCACTGGCTGCCCAGG - Intergenic
966874942 3:184316144-184316166 ACCACCGGCGCTGTCTGCCCCGG - Exonic
966989175 3:185211261-185211283 AGCATCAGCATTGGCTGCCCAGG + Intronic
985636403 5:1037941-1037963 AGCCTCGGAGCCTGCTGCCCGGG + Exonic
986501395 5:8403676-8403698 AGCATCTCCGCTGGCTGCCATGG + Intergenic
987719511 5:21616151-21616173 AGCATAGGGGCTGGTTGCCAGGG + Intergenic
988727940 5:33942403-33942425 ACCAGGGGCCCTGGCTGCCCAGG - Intergenic
990835582 5:60015476-60015498 AGCATAGCAGCTGGCTTCCCAGG - Intronic
992151560 5:73909599-73909621 AGCAGCGGCGCTGGCTGCGCAGG + Exonic
1006388079 6:33743108-33743130 AGCATCTCCTCTGGCTGGCCAGG - Intronic
1007162600 6:39803988-39804010 AGCATTGTCCCAGGCTGCCCAGG - Intronic
1007677651 6:43610610-43610632 AGCAGCGGCGCAGGCTGCTGAGG - Exonic
1008885878 6:56431273-56431295 AGAATCTGCCCTGGCTCCCCTGG - Intergenic
1019045056 6:169139473-169139495 AGCACCGGCCCTGGTTCCCCTGG - Intergenic
1019275434 7:173212-173234 AGCTTCGGCACTGGCAGCGCGGG - Intergenic
1019415689 7:925635-925657 AGCCTGGGCTCTGCCTGCCCAGG - Intronic
1019604164 7:1900239-1900261 AGCAAGGGCGCTGCCTGCCATGG + Intronic
1019768000 7:2865506-2865528 AGCTTTGGCCTTGGCTGCCCAGG + Intergenic
1019931526 7:4226415-4226437 ACCATCTGCCCGGGCTGCCCAGG - Intronic
1020016718 7:4835737-4835759 AGCAAAGGAGCTGGCTGCACAGG + Intronic
1022351068 7:29566328-29566350 AGCATCGCCGCTGTCGGCCATGG - Exonic
1022498655 7:30868928-30868950 AGGCTTGGCCCTGGCTGCCCTGG - Intronic
1023845189 7:44116466-44116488 AGCCTCCACGCTGGCTGCCTGGG + Exonic
1024471821 7:49774023-49774045 AGGATGGGCGCTGGCAACCCGGG + Exonic
1026465076 7:70646832-70646854 AGCCTCTGAGCTGGCTGGCCCGG - Intronic
1028121399 7:87059668-87059690 AGCATCGGCGCTGGCTGCCCGGG - Exonic
1032545280 7:132736975-132736997 AACCTCGGCGCTGTCTGACCTGG - Intergenic
1033659688 7:143394971-143394993 AGCATGGCCACTAGCTGCCCAGG + Exonic
1038441391 8:27573085-27573107 AGCAATGGTGCTGGGTGCCCAGG + Intergenic
1049616414 8:143577560-143577582 GGCGGCGGGGCTGGCTGCCCAGG - Intronic
1049660442 8:143817430-143817452 AGCAGCGGTGCTGGGTACCCTGG - Exonic
1049747833 8:144270508-144270530 AGCGGCTGGGCTGGCTGCCCAGG - Intronic
1051287407 9:15510820-15510842 AGCGTCGGCGCCCGCGGCCCCGG - Exonic
1051855481 9:21559842-21559864 AGCCACGGCGCTGGCGGCCCCGG - Intergenic
1053623158 9:39841521-39841543 AGCATAGGAGTTGGCTGACCTGG + Intergenic
1053881713 9:42601707-42601729 AGCATAGGAGTTGGCTGACCTGG - Intergenic
1058613375 9:106799475-106799497 AACATCGGTGCTGGCTTCCTGGG + Intergenic
1059239659 9:112793316-112793338 GGCATCTGGGTTGGCTGCCCTGG - Intronic
1060252314 9:121996158-121996180 TGCATTGGTGCTGGCTGCCAAGG - Intronic
1060480072 9:124012513-124012535 AGCAGAGGCGCTGACTGGCCCGG - Intronic
1061123156 9:128656611-128656633 TGCAGCGGCCCTGGCCGCCCCGG + Exonic
1061195164 9:129103442-129103464 AGCATCGGTTCTGGAGGCCCCGG + Intronic
1061208687 9:129178438-129178460 AGCAGCGGCGTTGGAGGCCCGGG - Intergenic
1061664469 9:132152390-132152412 GGCCGCGCCGCTGGCTGCCCAGG + Intergenic
1062043862 9:134416280-134416302 GGCATGAGCCCTGGCTGCCCAGG - Intronic
1193272366 X:79544377-79544399 AACATCAGGGCTTGCTGCCCAGG - Intergenic