ID: 1028121400

View in Genome Browser
Species Human (GRCh38)
Location 7:87059669-87059691
Sequence GAGCATCGGCGCTGGCTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 125
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 115}

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028121400_1028121405 -7 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121405 7:87059685-87059707 GATGCTCCCGTCACGCCGGAGGG 0: 1
1: 0
2: 0
3: 1
4: 20
1028121400_1028121418 22 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121418 7:87059714-87059736 CGCGGGGCGCGGGCGCGGCGCGG 0: 1
1: 3
2: 44
3: 224
4: 1280
1028121400_1028121416 17 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121416 7:87059709-87059731 GGGACCGCGGGGCGCGGGCGCGG 0: 1
1: 2
2: 14
3: 119
4: 792
1028121400_1028121406 -4 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121400_1028121412 6 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121412 7:87059698-87059720 CGCCGGAGGGAGGGACCGCGGGG 0: 1
1: 0
2: 1
3: 16
4: 176
1028121400_1028121404 -8 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121404 7:87059684-87059706 CGATGCTCCCGTCACGCCGGAGG 0: 1
1: 0
2: 0
3: 1
4: 22
1028121400_1028121420 24 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121420 7:87059716-87059738 CGGGGCGCGGGCGCGGCGCGGGG 0: 1
1: 3
2: 30
3: 224
4: 1213
1028121400_1028121415 12 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121415 7:87059704-87059726 AGGGAGGGACCGCGGGGCGCGGG 0: 1
1: 1
2: 2
3: 45
4: 437
1028121400_1028121419 23 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121419 7:87059715-87059737 GCGGGGCGCGGGCGCGGCGCGGG 0: 1
1: 12
2: 27
3: 245
4: 1345
1028121400_1028121410 4 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121410 7:87059696-87059718 CACGCCGGAGGGAGGGACCGCGG 0: 1
1: 0
2: 1
3: 10
4: 166
1028121400_1028121421 25 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121421 7:87059717-87059739 GGGGCGCGGGCGCGGCGCGGGGG 0: 1
1: 2
2: 38
3: 254
4: 1681
1028121400_1028121407 -3 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121407 7:87059689-87059711 CTCCCGTCACGCCGGAGGGAGGG 0: 1
1: 0
2: 0
3: 0
4: 61
1028121400_1028121414 11 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121414 7:87059703-87059725 GAGGGAGGGACCGCGGGGCGCGG 0: 1
1: 0
2: 9
3: 67
4: 813
1028121400_1028121411 5 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121411 7:87059697-87059719 ACGCCGGAGGGAGGGACCGCGGG 0: 1
1: 0
2: 2
3: 8
4: 127
1028121400_1028121423 29 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121423 7:87059721-87059743 CGCGGGCGCGGCGCGGGGGCGGG 0: 1
1: 1
2: 21
3: 225
4: 1380
1028121400_1028121422 28 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121422 7:87059720-87059742 GCGCGGGCGCGGCGCGGGGGCGG 0: 1
1: 1
2: 32
3: 243
4: 1540

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028121400 Original CRISPR GAGCATCGGCGCTGGCTGCC CGG (reversed) Exonic
900436466 1:2633432-2633454 GGGGGTGGGCGCTGGCTGCCAGG + Intergenic
901019763 1:6249708-6249730 GGGCGGCGGCGCGGGCTGCCGGG + Exonic
902377173 1:16035275-16035297 CAGCATCGGCGGCGGCTGCCCGG - Intergenic
902382351 1:16058534-16058556 CAGCATCGGCGGCGGCTGCCCGG - Exonic
904006381 1:27365553-27365575 GAGCATCCGGGCTGGCTGGAGGG + Intronic
906359263 1:45138780-45138802 GAGGATAGGAGCTGGTTGCCAGG - Intronic
908355775 1:63323820-63323842 GAGCTTCGGCGCTTACAGCCTGG + Exonic
912983435 1:114401317-114401339 GAGTATGGGCTCTGGCGGCCGGG - Intronic
912988504 1:114459167-114459189 CAGGATGGGTGCTGGCTGCCAGG + Intronic
915333636 1:155128368-155128390 GAACAAGGGCCCTGGCTGCCAGG - Intronic
924648500 1:245902290-245902312 AAGCATGGGAGCTGCCTGCCTGG + Intronic
1063117564 10:3082591-3082613 GAGGAACGGCCCTGGCTGGCAGG - Intronic
1069486551 10:68827503-68827525 GGTCCGCGGCGCTGGCTGCCGGG - Intergenic
1070579837 10:77710990-77711012 GAGCAGTGGCGGTGTCTGCCGGG + Intergenic
1071563336 10:86659275-86659297 GAGCACCTGCCCTGGCTCCCAGG + Exonic
1073829937 10:107372156-107372178 GAACAGGGGCCCTGGCTGCCAGG + Intergenic
1075195941 10:120359278-120359300 GACCCTCGGTTCTGGCTGCCTGG - Intergenic
1076587926 10:131561965-131561987 GAGCTTCAGCCCTGGCAGCCTGG + Intergenic
1077392902 11:2308224-2308246 GAGCGTGGGCGCTGGGTGCGTGG - Intronic
1081329290 11:41784680-41784702 CAGAATGGGGGCTGGCTGCCAGG + Intergenic
1082720101 11:56664027-56664049 GACCATAGGCCATGGCTGCCAGG - Exonic
1082810565 11:57476800-57476822 GTGCCCCGGCGCTGCCTGCCAGG + Exonic
1088695451 11:112362351-112362373 GAGCCTCGGGGCTCGCTGCCTGG - Intergenic
1090645970 11:128766900-128766922 AAGCATCGGTTCTGGCAGCCTGG - Intronic
1097855020 12:64452534-64452556 GGGCCTGGGCCCTGGCTGCCTGG + Intronic
1103082530 12:118036604-118036626 GAGAATCAGCCCTGGCTGCAGGG - Intronic
1106246423 13:27954023-27954045 GAGCAGCAGCGCCGCCTGCCGGG + Intergenic
1107617183 13:42181754-42181776 GACCATCAGACCTGGCTGCCAGG + Intronic
1124155265 15:27219630-27219652 GAGGTTGGGCGCTGTCTGCCTGG - Intronic
1128761293 15:70217740-70217762 GAGCATGGGCCCTGCCTGGCAGG + Intergenic
1129644628 15:77419521-77419543 GAGCATCGGCGCAGCCTCGCCGG - Intronic
1130152783 15:81324142-81324164 GAGCGGCGGCGCTGGATCCCGGG + Intronic
1132205379 15:99982843-99982865 GTGCGTCGGAGCTGGCTGCCCGG + Intronic
1132503765 16:296774-296796 GAGCATCTGTGCTGCCTGCGGGG + Intronic
1132549055 16:546887-546909 GAGCACTGGCGCTGGCCGGCCGG - Exonic
1133460929 16:5985563-5985585 TAGCCTTGGAGCTGGCTGCCTGG - Intergenic
1137440282 16:48492840-48492862 GAGCATTGTCGATGACTGCCTGG - Intergenic
1139563063 16:67756007-67756029 GAGCATCTGCACTGGCCACCTGG - Intronic
1139817097 16:69683812-69683834 GAGCCACCGCACTGGCTGCCAGG - Intronic
1140475009 16:75235440-75235462 TCGCACCGGCGCTGCCTGCCAGG + Exonic
1141580961 16:84998386-84998408 TGGCTTCGGCGCCGGCTGCCTGG + Intronic
1141627116 16:85267149-85267171 GAGCAGCGGCGGTGGCTGCCTGG + Intergenic
1141982074 16:87556929-87556951 GAGCAGCAGGGCTGGATGCCAGG + Intergenic
1142113641 16:88345171-88345193 GAGCATCTGGCCTGGGTGCCCGG - Intergenic
1143924679 17:10359173-10359195 CAGGATGGGGGCTGGCTGCCAGG + Intronic
1145368454 17:22286528-22286550 GCCCATCAGCGCTGGCAGCCGGG + Intergenic
1145740419 17:27269459-27269481 GAGAAGCTGGGCTGGCTGCCTGG + Intergenic
1147242526 17:39099857-39099879 GAGCCTCTACGGTGGCTGCCTGG + Intronic
1149684237 17:58526362-58526384 GAAGATTGGCGCTGGGTGCCGGG - Intronic
1150659946 17:67066467-67066489 AAGAATCGGCGCTGGATGCATGG + Intergenic
1151826805 17:76528387-76528409 GGGAGGCGGCGCTGGCTGCCTGG - Exonic
1151967003 17:77436724-77436746 CAGGATGGGGGCTGGCTGCCCGG - Intronic
1152784716 17:82241730-82241752 GGGCATCTGAGCTGGCTTCCGGG - Intronic
1152962699 18:89267-89289 GTGCACCTGCCCTGGCTGCCTGG - Intergenic
1157474423 18:48012189-48012211 GAGCCTGGGCGGGGGCTGCCAGG + Intergenic
1157588345 18:48819506-48819528 GAGCGCCGGCCCTGGCTGCTGGG + Intronic
1158635902 18:59157415-59157437 GAGCATCAGCACTGGCAGCCAGG - Intronic
1161013452 19:1971008-1971030 GAGCATGGGCTGTGGCGGCCTGG + Intronic
1162796371 19:13089612-13089634 GGGCCTAGGAGCTGGCTGCCTGG - Intronic
1165874034 19:38993086-38993108 GAGCATCTGCCCAGGCAGCCTGG - Intronic
1166042847 19:40213780-40213802 GAGCAGCGGCGCTGGCTCGACGG + Exonic
1166893630 19:46009576-46009598 GAGGCTCGGCGCTGGCTGCCTGG - Intronic
929483560 2:42335702-42335724 GAGCATGGCAGCTGGCTGCACGG - Intronic
933744592 2:85561411-85561433 GAGCAATGGCGGTGTCTGCCGGG - Exonic
935602613 2:104938511-104938533 GAGCAGCGGTGCAGGCTGTCAGG - Intergenic
936117785 2:109715771-109715793 CAGGATGGGGGCTGGCTGCCAGG - Intergenic
937423536 2:121778302-121778324 GAGCAGCGTGGCTTGCTGCCTGG - Intergenic
946410373 2:219512583-219512605 GAGCATAGGAGGCGGCTGCCTGG + Intergenic
947549791 2:231037900-231037922 GCGCGTCGTCGCTGGCCGCCCGG + Exonic
947877473 2:233477304-233477326 GGGCATGGGGACTGGCTGCCTGG - Exonic
948502537 2:238406032-238406054 CAGCATAGGCCCTGACTGCCAGG + Intergenic
948524110 2:238559894-238559916 GGGCTAAGGCGCTGGCTGCCAGG - Intergenic
949022827 2:241751197-241751219 GAGCAGAGGCTCCGGCTGCCAGG - Intronic
1169053955 20:2604632-2604654 CTGCATCTGGGCTGGCTGCCAGG + Intronic
1169143338 20:3238159-3238181 GACCAACGGCTCTGGCTTCCAGG - Exonic
1172298036 20:33827588-33827610 CAGCATCTGCGCTGCTTGCCTGG - Intronic
1175925022 20:62467269-62467291 GAGGCTCTGAGCTGGCTGCCTGG + Intronic
1176058754 20:63162577-63162599 GAGCATAGCCCCTGCCTGCCAGG + Intergenic
1178134507 21:29611965-29611987 GAGCCTCTGCTCTGGCTTCCAGG + Intronic
1182018441 22:27060694-27060716 GAGCATGGGCTCTGGCTAGCAGG + Intergenic
1182270303 22:29149120-29149142 CAGCATGGGGGCTGGCTGCAGGG - Intronic
1183566077 22:38616295-38616317 GAGCAGCTGCAGTGGCTGCCGGG + Intronic
1184233516 22:43171042-43171064 GAGCGTTGGGGCTGGCTGCATGG + Intronic
1184855896 22:47146553-47146575 CGGCATCGGTGCCGGCTGCCTGG - Intronic
953562131 3:43999445-43999467 GAGCCTACGCGCTGGGTGCCCGG - Intergenic
958798985 3:98734211-98734233 GAACATCTGCTCAGGCTGCCAGG + Intronic
959390789 3:105770645-105770667 GAGCATAGGAGCTGGGTGCCTGG + Intronic
961565456 3:127760448-127760470 CAGCATCGGGGCTGACTGCAGGG - Intronic
961745536 3:129061677-129061699 GAGGATCGGTCCAGGCTGCCAGG + Intronic
969497429 4:7534121-7534143 GAGCCTCTGTGCTGGGTGCCAGG - Intronic
969614414 4:8244084-8244106 GAACAACGGGACTGGCTGCCTGG - Intergenic
969684832 4:8665596-8665618 GAGCCTCTGCTCTGCCTGCCTGG + Intergenic
977573985 4:98658334-98658356 GGGCCGCGGCGCTGGCGGCCTGG + Exonic
980920718 4:139083581-139083603 GGACATCGCCCCTGGCTGCCTGG + Intronic
983649751 4:170026379-170026401 GAGCTGCGCCGCCGGCTGCCGGG + Exonic
985580732 5:693975-693997 GAGCAGCTGCGCTGGGCGCCCGG - Intergenic
985595354 5:785307-785329 GAGCAGCTGCGCTGGGCGCCCGG - Intergenic
987719510 5:21616150-21616172 TAGCATAGGGGCTGGTTGCCAGG + Intergenic
995561784 5:113389672-113389694 TAGCATCAACACTGGCTGCCAGG - Intronic
997402111 5:133611667-133611689 AAGCAGCGCCGCAGGCTGCCTGG + Intronic
998137239 5:139680529-139680551 GAGCCTCGGCGGTGGCTCCCAGG + Exonic
998147720 5:139739677-139739699 GAGCATCAGCCCTGGCTCCATGG - Intergenic
1002441335 5:179265934-179265956 GCGCCTCGGCGCTGGATCCCTGG - Intronic
1002780663 6:363023-363045 GAGCATCTGCGCCTGCTCCCAGG - Intergenic
1005244964 6:23873022-23873044 GAGCATGGGGGCTGGTTGCTGGG - Intergenic
1014098247 6:117482807-117482829 GCGCACTGGCGCGGGCTGCCGGG + Exonic
1015310849 6:131765724-131765746 GAGCTGCGGCCCTGGCTGTCAGG + Intergenic
1016884296 6:148944725-148944747 GAGCATGGGCAATGGCTGCTGGG + Intronic
1019902258 7:4030103-4030125 AAGCATCGGCTCCGGGTGCCTGG + Intronic
1023845188 7:44116465-44116487 CAGCCTCCACGCTGGCTGCCTGG + Exonic
1023967016 7:44967984-44968006 GAGCAGGGGCGGGGGCTGCCAGG + Intronic
1024063101 7:45713527-45713549 GAGTAGGGGCCCTGGCTGCCAGG + Intronic
1028121400 7:87059669-87059691 GAGCATCGGCGCTGGCTGCCCGG - Exonic
1029746501 7:102518017-102518039 GAGCCACCGCGCCGGCTGCCCGG - Intergenic
1029764438 7:102616996-102617018 GAGCCACCGCGCCGGCTGCCCGG - Intronic
1032516283 7:132508592-132508614 GGACAGCGGGGCTGGCTGCCGGG + Exonic
1044838115 8:96315253-96315275 GAGGCTGGGCCCTGGCTGCCAGG + Intronic
1045224644 8:100232516-100232538 GAGCATCTGAGCTTGCTGACTGG - Intronic
1054781981 9:69174152-69174174 GCGCCTCCGCGCTGGCCGCCCGG - Intronic
1058613374 9:106799474-106799496 TAACATCGGTGCTGGCTTCCTGG + Intergenic
1062324876 9:136008005-136008027 GAACATAGGAGCCGGCTGCCTGG - Exonic
1062402962 9:136380474-136380496 GGACATGGGCGCTGTCTGCCGGG - Intronic
1062735441 9:138134850-138134872 GTGCACCTGCCCTGGCTGCCTGG + Intergenic
1186503691 X:10072985-10073007 GAGCTTCTGTGCTAGCTGCCTGG + Intronic
1195654815 X:107324168-107324190 GGGCCTCGGCCCTGGCTGTCGGG - Intergenic