ID: 1028121406

View in Genome Browser
Species Human (GRCh38)
Location 7:87059688-87059710
Sequence GCTCCCGTCACGCCGGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028121400_1028121406 -4 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121394_1028121406 25 Left 1028121394 7:87059640-87059662 CCCGCTGACAGCTCTGCTGCGCT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121393_1028121406 28 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121399_1028121406 -3 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121395_1028121406 24 Left 1028121395 7:87059641-87059663 CCGCTGACAGCTCTGCTGCGCTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028121406 Original CRISPR GCTCCCGTCACGCCGGAGGG AGG Exonic
919513582 1:198494807-198494829 GCTGCTGTCCCGCCGGTGGGTGG + Intergenic
1062944490 10:1450152-1450174 GCTCCCGTCGAGAGGGAGGGAGG + Intronic
1090517890 11:127448183-127448205 GCTCCAGGCAGGCCGGACGGAGG - Intergenic
1098045801 12:66399199-66399221 GCTCCTGGCACGGTGGAGGGAGG - Intronic
1104889441 12:132133171-132133193 GCCCCCGTCAGGCGGGGGGGAGG - Intergenic
1111738863 13:92176696-92176718 GCTCCAGGCACTCTGGAGGGAGG - Intronic
1112091605 13:96090098-96090120 GCTCCTGTCACACCGGCTGGCGG + Intergenic
1113750715 13:112774920-112774942 GCTCCCGTGACGGGGGAAGGTGG - Intronic
1122666704 14:103334762-103334784 GCTCCCGCCATGCCGGGGAGGGG - Intronic
1128074279 15:64816583-64816605 GCTCCTGCCCCGCCGCAGGGTGG + Exonic
1132846229 16:2002080-2002102 GCTCCAGCCTGGCCGGAGGGTGG + Intronic
1134121517 16:11587363-11587385 GCTCCCGGCCCTCTGGAGGGCGG + Exonic
1138207499 16:55135510-55135532 GCTCCCATCAAGCTGTAGGGAGG + Intergenic
1142631484 17:1229167-1229189 GCTCCCGGCACGGACGAGGGGGG - Intergenic
1143621949 17:8085915-8085937 GCTCCCATCAAGCCAGAGGGGGG - Intronic
1151996245 17:77611102-77611124 GCTCCCTTCTCGGTGGAGGGAGG - Intergenic
1152548929 17:81019666-81019688 GCTCCCGCCTCCCCGGAGTGGGG - Intergenic
1158572900 18:58611912-58611934 GCTCACTGCACGCTGGAGGGTGG + Intronic
1160620767 18:80169100-80169122 GCTCCGGTCACTCAGGAAGGTGG + Exonic
1161007353 19:1943175-1943197 GTTCCCTTCACCCCGGTGGGAGG + Intronic
1162672123 19:12266234-12266256 GGTCCCGACACGCGGGAGGAGGG - Intronic
1164507172 19:28870038-28870060 GCTCCCATCACAGAGGAGGGTGG - Intergenic
1164507277 19:28870417-28870439 GCTCCCCTCACAGAGGAGGGCGG - Intergenic
1165479633 19:36054954-36054976 GCCATCGTCACGCCGGAGGCGGG - Exonic
1167307949 19:48719782-48719804 GCTCCCGTCACACCCCAGGAAGG - Intergenic
927095691 2:19746181-19746203 GCTCCCAGCACACTGGAGGGTGG + Intergenic
930946758 2:57084779-57084801 GCTCCCGGCACCCAAGAGGGAGG + Intergenic
937421034 2:121755609-121755631 GCTCGCGGCGCGCCGGAGGACGG - Exonic
948053641 2:234995873-234995895 GCTCCCCTGACGCCCCAGGGAGG - Intronic
949049225 2:241888358-241888380 GCTCAGGTCAGGCTGGAGGGTGG + Intergenic
1176221954 20:63973976-63973998 GCTCAAGTCACGCCTGTGGGCGG - Intronic
963799107 3:149658884-149658906 GCTCCAGGCTCCCCGGAGGGCGG - Intronic
966982727 3:185153030-185153052 GCGCGCGCCGCGCCGGAGGGAGG - Intergenic
967028782 3:185586644-185586666 GCTCCCGCCAGGCTGTAGGGAGG + Intronic
968805877 4:2772109-2772131 GCTCCCGTCATGCTGCAGTGGGG + Intergenic
982712176 4:158768865-158768887 GCTCACGTAACCCCGGCGGGAGG - Intergenic
997647232 5:135489497-135489519 GCCCCTGTCCGGCCGGAGGGAGG + Intergenic
1002277681 5:178114155-178114177 GCTCCCGGCAGGCCTCAGGGAGG + Intronic
1015328577 6:131951306-131951328 GCTGCCGTCGAGCTGGAGGGTGG + Exonic
1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG + Exonic
1029495163 7:100892605-100892627 GGACCCGGCACGCCTGAGGGAGG - Exonic
1029915739 7:104208041-104208063 GCTGCCGTCACGCCGCAGCCCGG - Exonic
1049389492 8:142360628-142360650 GCTCCCTTCAGGCTGGTGGGGGG - Intronic
1200152765 X:153959364-153959386 CCTCCCTTCCCGCCGGAGTGCGG - Exonic