ID: 1028121406

View in Genome Browser
Species Human (GRCh38)
Location 7:87059688-87059710
Sequence GCTCCCGTCACGCCGGAGGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 44
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 42}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028121395_1028121406 24 Left 1028121395 7:87059641-87059663 CCGCTGACAGCTCTGCTGCGCTC 0: 1
1: 0
2: 0
3: 20
4: 193
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121400_1028121406 -4 Left 1028121400 7:87059669-87059691 CCGGGCAGCCAGCGCCGATGCTC 0: 1
1: 0
2: 2
3: 7
4: 115
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121393_1028121406 28 Left 1028121393 7:87059637-87059659 CCGCCCGCTGACAGCTCTGCTGC 0: 1
1: 0
2: 0
3: 13
4: 236
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121399_1028121406 -3 Left 1028121399 7:87059668-87059690 CCCGGGCAGCCAGCGCCGATGCT 0: 1
1: 0
2: 3
3: 16
4: 124
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42
1028121394_1028121406 25 Left 1028121394 7:87059640-87059662 CCCGCTGACAGCTCTGCTGCGCT 0: 1
1: 0
2: 1
3: 19
4: 177
Right 1028121406 7:87059688-87059710 GCTCCCGTCACGCCGGAGGGAGG 0: 1
1: 0
2: 0
3: 1
4: 42

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028121406 Original CRISPR GCTCCCGTCACGCCGGAGGG AGG Exonic