ID: 1028122458

View in Genome Browser
Species Human (GRCh38)
Location 7:87071448-87071470
Sequence GACTTACTTATTGTGCCGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028122458_1028122462 27 Left 1028122458 7:87071448-87071470 CCAGCCGGCACAATAAGTAAGTC No data
Right 1028122462 7:87071498-87071520 AGCCAGCTGTTTTTGAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028122458 Original CRISPR GACTTACTTATTGTGCCGGC TGG (reversed) Intergenic
No off target data available for this crispr