ID: 1028124708

View in Genome Browser
Species Human (GRCh38)
Location 7:87099388-87099410
Sequence CTTCAAAACCAGCTGAGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028124708_1028124713 -6 Left 1028124708 7:87099388-87099410 CCTAGCCTCAGCTGGTTTTGAAG No data
Right 1028124713 7:87099405-87099427 TTGAAGCAGAATAGGGACTAGGG No data
1028124708_1028124715 8 Left 1028124708 7:87099388-87099410 CCTAGCCTCAGCTGGTTTTGAAG No data
Right 1028124715 7:87099419-87099441 GGACTAGGGTGAGGCAAGTTAGG No data
1028124708_1028124714 -1 Left 1028124708 7:87099388-87099410 CCTAGCCTCAGCTGGTTTTGAAG No data
Right 1028124714 7:87099410-87099432 GCAGAATAGGGACTAGGGTGAGG No data
1028124708_1028124716 21 Left 1028124708 7:87099388-87099410 CCTAGCCTCAGCTGGTTTTGAAG No data
Right 1028124716 7:87099432-87099454 GCAAGTTAGGTGTTCACCTCAGG No data
1028124708_1028124712 -7 Left 1028124708 7:87099388-87099410 CCTAGCCTCAGCTGGTTTTGAAG No data
Right 1028124712 7:87099404-87099426 TTTGAAGCAGAATAGGGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028124708 Original CRISPR CTTCAAAACCAGCTGAGGCT AGG (reversed) Intergenic
No off target data available for this crispr