ID: 1028130577

View in Genome Browser
Species Human (GRCh38)
Location 7:87167865-87167887
Sequence TCTAAGCTAGAATTTTTGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028130575_1028130577 8 Left 1028130575 7:87167834-87167856 CCTATCTATACAGATGTAATCCT 0: 1
1: 0
2: 0
3: 9
4: 110
Right 1028130577 7:87167865-87167887 TCTAAGCTAGAATTTTTGAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028130577 Original CRISPR TCTAAGCTAGAATTTTTGAG TGG Intronic
No off target data available for this crispr