ID: 1028130813

View in Genome Browser
Species Human (GRCh38)
Location 7:87170552-87170574
Sequence CTAGTTTTACAGGTATCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 182}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028130813_1028130816 6 Left 1028130813 7:87170552-87170574 CCTTGAGATACCTGTAAAACTAG 0: 1
1: 0
2: 1
3: 12
4: 182
Right 1028130816 7:87170581-87170603 TCCTCACTTGTTCCAAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028130813 Original CRISPR CTAGTTTTACAGGTATCTCA AGG (reversed) Intronic
902705762 1:18203143-18203165 CTAGTTTTACTGAAACCTCATGG + Intronic
903309560 1:22443957-22443979 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
905921481 1:41722336-41722358 CTAGTTTTCCACATATATCAGGG + Intronic
907777267 1:57530094-57530116 CTATTATTACATGCATCTCAGGG - Intronic
910542014 1:88370321-88370343 CTAGTTTTACACTTGCCTCAGGG + Intergenic
911841992 1:102694487-102694509 CAAGATTTACAAGTATCTCGAGG - Intergenic
912331666 1:108825976-108825998 CTAGTATTACAGGCAACTGATGG - Intronic
912684377 1:111750322-111750344 CCATTTTTACATGTGTCTCATGG - Intronic
917489962 1:175489580-175489602 CTAGTGTTTCAGGTCTCCCAGGG - Intronic
919615967 1:199809173-199809195 ATACTTTTAGAGGTATTTCAAGG + Intergenic
920188643 1:204178459-204178481 CTAGATCTACTGGTAGCTCAGGG - Intergenic
921236924 1:213141686-213141708 CTTGTTTTTCAGGTTTCTCTAGG + Intronic
921593403 1:217029121-217029143 CTATTTATACAGGTAAGTCATGG - Intronic
922299345 1:224282903-224282925 CTAATTTTATATGTATCTCTAGG + Intronic
922878468 1:228960416-228960438 TCAGTTTTTCAGGTTTCTCATGG + Intergenic
923779482 1:237009400-237009422 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
923803866 1:237237415-237237437 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
924353105 1:243138148-243138170 CTAGATTGATAGTTATCTCAAGG - Intronic
1064064050 10:12165457-12165479 TGACTTTTACAGGCATCTCAGGG - Exonic
1073953749 10:108842734-108842756 ATAGTTTTAAAGTTATATCAGGG + Intergenic
1077687365 11:4308127-4308149 CTAGTTTTATAGGTAAAACAAGG - Intergenic
1078208221 11:9248690-9248712 TTAGTTTTTCAGGTTTCTCTAGG + Intronic
1078478957 11:11659566-11659588 CTAGTTTCACAGGTATGCCATGG + Intergenic
1079674404 11:23207370-23207392 TTAGTTTTAAAGGTCTTTCATGG - Intergenic
1079688964 11:23398531-23398553 CTAGTTTTAAATGCATCTTAGGG - Intergenic
1080962587 11:37177900-37177922 GTAGTTTTTCAGGTTTCTCTGGG - Intergenic
1082237020 11:49830780-49830802 TTAGTTTTACCAGCATCTCAAGG + Intergenic
1082769442 11:57195436-57195458 CCAGCTTTACACCTATCTCATGG + Intergenic
1082866403 11:57903655-57903677 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1091302481 11:134516232-134516254 CCAGGTTTGCAGGTCTCTCAGGG + Intergenic
1092769243 12:11881839-11881861 CTCGTTTTACAGGCATTTGAAGG - Intronic
1093204916 12:16236794-16236816 GGAGTTTTTCAGGTATTTCATGG + Intronic
1093634034 12:21442871-21442893 CTAGTTTCTCAGGTATGCCAGGG + Intronic
1093812205 12:23504780-23504802 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1094212367 12:27905946-27905968 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1094302511 12:28981260-28981282 CTAGATTATCAGATATCTCAAGG + Intergenic
1096220784 12:49827409-49827431 CTGGTTTTCCAGGCATCCCAGGG - Intronic
1098528038 12:71509365-71509387 CTGATTTTGCAGGAATCTCAGGG + Intronic
1099274802 12:80561213-80561235 CTAATTTTTCAGGTCTCTCCTGG - Intronic
1101400021 12:104379066-104379088 CTAATTTGACAGGTGTCACATGG + Intergenic
1101609421 12:106277040-106277062 CTAGTTTTTCAGGTTTCTTTGGG - Intronic
1102444424 12:112990892-112990914 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1106015975 13:25869565-25869587 CTTGTTTTTCAGGTATATGAAGG + Intronic
1106891863 13:34254567-34254589 CTAGTTTCCCAGGTGACTCATGG - Intergenic
1108883245 13:55147428-55147450 TTAGGTTTTCAGGTTTCTCAGGG - Intergenic
1110319348 13:74142709-74142731 CTATATTTACAGGTATCATAGGG - Intergenic
1111034784 13:82657932-82657954 CTAGTTTTTCAGGTATCTTTGGG + Intergenic
1111787597 13:92809882-92809904 CTAGGTTTACAAGTTTCTCTAGG - Intronic
1112837726 13:103536266-103536288 TGAGTTTAACAGGTACCTCAGGG + Intergenic
1113918664 13:113890867-113890889 TTAGTTTTTCAGGTTTCTCTGGG - Intergenic
1114343874 14:21774872-21774894 CTATTGTTGCAGGTATCTCCAGG - Intergenic
1118049068 14:62006113-62006135 CTAGTTTTATAGGGCCCTCAGGG - Intronic
1118330664 14:64813311-64813333 CTAGTTTTACCTGTAGCTTAAGG - Intronic
1119269826 14:73293113-73293135 CTAGTTTTACATCTCTTTCATGG + Intronic
1119656369 14:76420116-76420138 CTGGTTTCACAGGTAACTCAAGG - Intronic
1125437818 15:39666843-39666865 CTATTTTTATAGGAAACTCATGG - Intronic
1126313777 15:47346243-47346265 CCAGTTTTTCATGTAGCTCAAGG + Intronic
1129046490 15:72739152-72739174 CTAGCTATTCAGGTATCTGATGG - Intergenic
1131464961 15:92647486-92647508 TTAGTTTTTCAGGTTTCTCTGGG - Intronic
1134338686 16:13325439-13325461 CTAGTTTTTCAGGTTTCTTTAGG + Intergenic
1141046340 16:80719232-80719254 TCAGTTTTACAGGTACCTCTGGG - Intronic
1144728930 17:17515621-17515643 CCAGGTTTACTGGAATCTCATGG + Intronic
1146592072 17:34136008-34136030 CTAGTTTTTCAGGTTTCTCCAGG - Intronic
1148725956 17:49790052-49790074 CCAGTTTTCCAAGTATCTTAAGG - Intronic
1149021044 17:51964834-51964856 CTTGTTTTTCAGGTTTCTCTAGG - Intronic
1150062237 17:62078391-62078413 CTAGGGCTACAGTTATCTCAAGG + Intergenic
1150972904 17:70050069-70050091 CTAGTCTTAGAGGTATCTGCCGG + Intergenic
1153183656 18:2463907-2463929 CTAGACTGACAGGAATCTCAGGG - Intergenic
1156964270 18:43071584-43071606 CAGGTTGTACAGATATCTCAAGG + Intronic
1158569291 18:58583363-58583385 CTAGTTTTTTAGGTTTCTTAGGG + Intronic
1159992711 18:74928798-74928820 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1164123354 19:22287691-22287713 CATTTTTTACAGGTATCCCAAGG + Intronic
1164472932 19:28550819-28550841 CTAGTTTTCCAGATTTCTCTGGG - Intergenic
1164696658 19:30249855-30249877 CTAGGTTTGCAGCTATCTCTTGG - Intronic
925791575 2:7493650-7493672 CCATTTTAACAGGTATGTCATGG - Intergenic
928069513 2:28200732-28200754 CTAGTTTACCAGGTATCTATGGG + Intronic
928483936 2:31710864-31710886 CTAGTTTTAAATTTATATCAAGG + Intergenic
929302525 2:40322195-40322217 CGAGTTTTCCAGGTATCCCTGGG + Intronic
930961511 2:57267336-57267358 CTAGGTTTTCAGGCATCTGATGG + Intergenic
931066868 2:58597422-58597444 CAACTTTTACATGAATCTCATGG + Intergenic
932057003 2:68455826-68455848 CTACTTCTACAGCTATCTCATGG + Intergenic
934881371 2:97983375-97983397 CTAGTTTTTCAGGTCTCTTCGGG + Intronic
938036149 2:128036664-128036686 CTAGTTTTTCAGGTGTCTTTGGG + Intergenic
939131353 2:138239232-138239254 ATAGTTTTACATGTAGCTCTAGG - Intergenic
942699768 2:178692557-178692579 CTGGTTTCTCAGGTAGCTCAGGG + Exonic
943663542 2:190585028-190585050 CTGGTTATCCAGGTTTCTCAGGG - Intergenic
945882100 2:215336023-215336045 ATATTTTTGCAGGTATCTGATGG + Exonic
1169420541 20:5455492-5455514 CAATTTGTACAGGTATCTGAGGG - Intergenic
1172429864 20:34880719-34880741 CTAGTTTTCTAGGTATATAATGG + Intronic
1182972039 22:34588349-34588371 CAAGTTTTACAGGAAACTAAAGG + Intergenic
949112638 3:281073-281095 CTTGTATTACTGGTTTCTCAAGG + Intronic
949343707 3:3056674-3056696 ACAGTTTTACAAGGATCTCATGG + Exonic
949810556 3:8002119-8002141 CTCATTTTAGAGGAATCTCAGGG - Intergenic
949839144 3:8301459-8301481 CTAGTTTTAAAAATATCTGAAGG + Intergenic
950920651 3:16690686-16690708 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
952628730 3:35439509-35439531 CCAGTTTTTCAGGTTTCTCTGGG + Intergenic
953855491 3:46496663-46496685 TTAGTTTTTCAGGTTTCTCAGGG + Intergenic
954720350 3:52556697-52556719 ATGGTTTTACAGGTTTCTTAGGG - Intronic
957130881 3:76221459-76221481 CTCATTTTACAAGTAACTCAGGG + Intronic
957181117 3:76878746-76878768 CTAATTTTTAAGGTATCTCTGGG - Intronic
957552284 3:81721759-81721781 CTACTCTTACAAGCATCTCATGG - Intronic
958057730 3:88434692-88434714 CTACTTTAACAGTTATTTCAAGG + Intergenic
959372300 3:105542812-105542834 CTATTTTTACAGGGCTCTCAAGG - Intronic
961100308 3:124192926-124192948 CTAGTTTAATAGTTAACTCATGG - Intronic
964512996 3:157474209-157474231 CTGCTTTTACTGGTATCTCCTGG + Intronic
965201719 3:165667043-165667065 TTAGTTTTATAGGTATCTCAAGG + Intergenic
967106573 3:186259428-186259450 TTACTTTTACAGGTAAATCATGG + Intronic
968918067 4:3505982-3506004 CTGGGTTTCCAGGTATCTCTAGG - Intergenic
970695264 4:18669432-18669454 CTGGCCTTACAGGTATTTCATGG - Intergenic
971529251 4:27663709-27663731 CTAGTTCTGAAGGTATTTCATGG + Intergenic
971822422 4:31575506-31575528 TTAGTCTTGCAGATATCTCAGGG + Intergenic
976936258 4:90638399-90638421 GTTGTTTTACAGGTCTCACAAGG - Intronic
977352960 4:95911319-95911341 ATATTTTAACAGGTATCTCAGGG - Intergenic
977578202 4:98697077-98697099 CTAGTTTTTCAGGTTTCTTTAGG - Intergenic
978728332 4:111996922-111996944 CTTGTTATGCTGGTATCTCATGG - Intergenic
979248842 4:118542378-118542400 CTAGATTGATAGTTATCTCAAGG + Intergenic
982143466 4:152354506-152354528 CTAGTATTACACGTGTCTTATGG - Intronic
982971906 4:161999054-161999076 CTAGTTTTTCAGGTTTCTAAGGG + Intronic
983778852 4:171643024-171643046 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
987144894 5:14982520-14982542 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
987652005 5:20753563-20753585 CTAGTTTTACTAGTATCTTGTGG + Intergenic
988743555 5:34107913-34107935 CTAGTTTTACTAGTATCTTGTGG - Intronic
990086042 5:51979000-51979022 CTAGTCTCACAGGTATCAAATGG - Intergenic
990086568 5:51985978-51986000 CTTGTTCTCCAGGTATCACATGG - Intergenic
994026711 5:95092920-95092942 CTGGTCTTCCAGGTATCTTAAGG + Intronic
994141745 5:96348826-96348848 CTAATTCCCCAGGTATCTCAGGG - Intergenic
994887335 5:105581996-105582018 ATAGTTTTCCAGCTTTCTCATGG - Intergenic
995020049 5:107356364-107356386 TTATTTTTATAGTTATCTCAGGG + Intergenic
995454123 5:112333992-112334014 CTAGTTTTTCAGGTTTCACTGGG - Intronic
995605220 5:113847065-113847087 CTAGTCTTACAGGTAACTGCAGG + Intergenic
996916375 5:128716712-128716734 ATAGTTTTACAGTTGTCTCCTGG + Intronic
996960813 5:129246867-129246889 CTCGTTTTACAGATATTTCAGGG - Intergenic
997897444 5:137732327-137732349 CTAGATTTCCAGGTCTCTCCTGG - Intronic
1002869614 6:1155188-1155210 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1007994236 6:46289114-46289136 CTAGTTTAACAGGGAGCACAGGG + Intronic
1010372312 6:75124831-75124853 CTAATTTTACAGGTCATTCATGG + Intronic
1011029588 6:82907463-82907485 TGAGTTTTACAGGAAACTCAGGG - Intronic
1013287650 6:108694672-108694694 CTTGTTTTGCAGGGATCCCATGG - Intergenic
1016293786 6:142552198-142552220 CTAGTTTTTCAGGTCTCTTTGGG - Intergenic
1018860993 6:167710416-167710438 CTCGTTGTACAGGCATCACATGG + Intergenic
1019657035 7:2201372-2201394 CTACTTTTACAGGTAGAGCAGGG - Intronic
1019823514 7:3264136-3264158 CTAATTATCCAGGTAACTCAGGG + Intergenic
1021003698 7:15366870-15366892 CTATCTTTCCAGGTATCTTAAGG + Intronic
1021641753 7:22744420-22744442 CTAGTTTTTCAGGTTTCTTCGGG + Intergenic
1022176448 7:27875834-27875856 CTAGTTTTCCAGGTATAACTAGG - Intronic
1025164559 7:56701462-56701484 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1025705718 7:63860614-63860636 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1027533886 7:79370940-79370962 CCAGTTTTTCAGGGATCTCATGG + Intronic
1028130813 7:87170552-87170574 CTAGTTTTACAGGTATCTCAAGG - Intronic
1028644989 7:93086203-93086225 ATTGTTTTTCAGGTATTTCATGG + Intergenic
1029136177 7:98373785-98373807 CTATTTACACAGGTATCTCCAGG + Intronic
1031188839 7:118519830-118519852 CTAGTTTTTCAGGTTTCTTTGGG + Intergenic
1036138827 8:6187477-6187499 CAATTTTTGAAGGTATCTCAAGG + Intergenic
1036537562 8:9665197-9665219 CTAGTTTGACAGGAAGCTCAAGG - Intronic
1037198111 8:16217043-16217065 CTAATTATACATATATCTCAGGG - Intronic
1037277629 8:17198592-17198614 CTGGTTTTAAAAGTATTTCATGG - Intronic
1037390976 8:18391458-18391480 TTAGTTTTCCAGGTTTCTCTGGG - Intronic
1038609966 8:29051504-29051526 CTAGTGTTACAAGAATCTAAAGG - Exonic
1038814036 8:30882599-30882621 CTATGTTGACATGTATCTCATGG + Intronic
1041271171 8:56110919-56110941 CTAATTTTGCAGGTCTCTCTGGG + Intergenic
1042067821 8:64898348-64898370 CTAGATATATGGGTATCTCATGG - Intergenic
1043924535 8:86022014-86022036 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1045296702 8:100877703-100877725 CTAATTTCACAAGTGTCTCAAGG - Intergenic
1046813239 8:118555332-118555354 CAAGTTTCACAGTTTTCTCATGG + Intronic
1047544827 8:125805336-125805358 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1050713152 9:8489002-8489024 CTAGCTTTACGTGCATCTCACGG - Intronic
1050797699 9:9565002-9565024 CTAGTTTCAAAATTATCTCAAGG + Intronic
1051500780 9:17775533-17775555 TCAGTTTTTCAGGTATTTCAGGG + Intronic
1051992830 9:23174113-23174135 CAAGTTATACAGCTAGCTCATGG - Intergenic
1053574073 9:39340068-39340090 CTAATTTTACACGTAATTCAAGG + Intergenic
1053625110 9:39862157-39862179 CTAATTTTACACGTAATTCAAGG + Intergenic
1053838634 9:42168314-42168336 CTAATTTTACACGTAATTCAAGG + Intergenic
1053879759 9:42581071-42581093 CTAATTTTACACGTAATTCAAGG - Intergenic
1053892906 9:42713253-42713275 CTAATTTTACACGTAATTCAAGG + Intergenic
1054095639 9:60898761-60898783 CTAATTTTACACGTAATTCAAGG + Intergenic
1054117100 9:61174699-61174721 CTAATTTTACACGTAATTCAAGG + Intergenic
1054218785 9:62388541-62388563 CTAATTTTACACGTAATTCAAGG - Intergenic
1054231932 9:62520628-62520650 CTAATTTTACACGTAATTCAAGG + Intergenic
1054590654 9:67007869-67007891 CTAATTTTACACGTAATTCAAGG - Intergenic
1055034063 9:71799224-71799246 CTAGTTCCAAAGTTATCTCAGGG - Intronic
1055108737 9:72538963-72538985 CTAGTTTTTCAGGTTTCTTTGGG + Intronic
1055233598 9:74091720-74091742 CTAGTTTTTCAGGTTTCTTTGGG - Intergenic
1055547148 9:77390356-77390378 CTAGTTTAGCAGGAATCTCTTGG + Intronic
1056209102 9:84348494-84348516 TTATGTTTACAGCTATCTCATGG + Intergenic
1056298509 9:85218124-85218146 CTAGGATTACAGGCATCTGAGGG + Intergenic
1058068189 9:100572847-100572869 CCAGTCTTACAGGTATATCTGGG + Intronic
1059634857 9:116160531-116160553 CTGGTTTCAGAGGGATCTCAAGG - Intronic
1061566007 9:131440668-131440690 ATAATTTTACAGGCATTTCAAGG - Intronic
1185971628 X:4671522-4671544 CCAGTTTTTCAGGTTTCTCTGGG - Intergenic
1186034204 X:5403233-5403255 TTAGTTTTTCAGGTTTCTCTGGG + Intergenic
1189868013 X:45351767-45351789 CTAGTTTTTCAGCTGTTTCAGGG - Intergenic
1190477017 X:50838601-50838623 TAAGTTTGACAGGTATTTCAAGG + Intergenic
1193202982 X:78714477-78714499 ACAGTTTTTCAGCTATCTCACGG - Intergenic
1194850538 X:98863675-98863697 CAAGTTATACAGGTATTTGATGG + Intergenic
1198140456 X:133797481-133797503 CTAGTCTTTAAGGAATCTCAGGG - Intronic
1199605190 X:149572330-149572352 GTAGTTTTAAAGGTAACTGATGG - Intergenic