ID: 1028131507

View in Genome Browser
Species Human (GRCh38)
Location 7:87181002-87181024
Sequence CAGAAAAATTAGCTGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 648
Summary {0: 1, 1: 2, 2: 17, 3: 71, 4: 557}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028131507_1028131514 9 Left 1028131507 7:87181002-87181024 CCTGCCACCAGCTAATTTTTCTG 0: 1
1: 2
2: 17
3: 71
4: 557
Right 1028131514 7:87181034-87181056 GAGATGGGGTTTTGCCATGTTGG 0: 5298
1: 16700
2: 72776
3: 120219
4: 129534
1028131507_1028131513 -5 Left 1028131507 7:87181002-87181024 CCTGCCACCAGCTAATTTTTCTG 0: 1
1: 2
2: 17
3: 71
4: 557
Right 1028131513 7:87181020-87181042 TTCTGTTTTTGGTAGAGATGGGG 0: 9
1: 392
2: 10814
3: 117742
4: 210764
1028131507_1028131511 -7 Left 1028131507 7:87181002-87181024 CCTGCCACCAGCTAATTTTTCTG 0: 1
1: 2
2: 17
3: 71
4: 557
Right 1028131511 7:87181018-87181040 TTTTCTGTTTTTGGTAGAGATGG 0: 14
1: 754
2: 20911
3: 237497
4: 154421
1028131507_1028131515 14 Left 1028131507 7:87181002-87181024 CCTGCCACCAGCTAATTTTTCTG 0: 1
1: 2
2: 17
3: 71
4: 557
Right 1028131515 7:87181039-87181061 GGGGTTTTGCCATGTTGGCCAGG 0: 8131
1: 28392
2: 108920
3: 195222
4: 205144
1028131507_1028131512 -6 Left 1028131507 7:87181002-87181024 CCTGCCACCAGCTAATTTTTCTG 0: 1
1: 2
2: 17
3: 71
4: 557
Right 1028131512 7:87181019-87181041 TTTCTGTTTTTGGTAGAGATGGG 0: 8
1: 438
2: 11742
3: 130527
4: 285467
1028131507_1028131516 18 Left 1028131507 7:87181002-87181024 CCTGCCACCAGCTAATTTTTCTG 0: 1
1: 2
2: 17
3: 71
4: 557
Right 1028131516 7:87181043-87181065 TTTTGCCATGTTGGCCAGGCTGG 0: 13466
1: 38217
2: 134614
3: 201451
4: 192209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028131507 Original CRISPR CAGAAAAATTAGCTGGTGGC AGG (reversed) Intronic
900211521 1:1458573-1458595 CAAAAAAGTTAGCTGGGGCCTGG - Intronic
901074370 1:6543827-6543849 CAAAAAAATTAGCCAGAGGCCGG + Intronic
901495099 1:9616420-9616442 CAAGAAAATTAGCTGGGGCCGGG + Intergenic
901754383 1:11432503-11432525 TACAAAAATTAGCTGGGTGCGGG - Intergenic
901925037 1:12560777-12560799 TACAAAAATTAGCTGGGTGCAGG - Intergenic
902293248 1:15448639-15448661 CAAAAAAATTAGCTGGGGCCGGG - Intronic
902324646 1:15691795-15691817 CAAAAAAATTAGCTGGGGGCGGG + Intronic
902882684 1:19383148-19383170 CAAAAAAATTAGCTGGGGCTGGG + Intronic
903425025 1:23247054-23247076 ATGAAAAATCGGCTGGTGGCCGG + Intergenic
903797971 1:25944542-25944564 GAGAAAAATAGGCTGCTGGCTGG + Intergenic
903941177 1:26932473-26932495 CAGAAAAATTAGCTGGGGGCCGG - Intronic
904122316 1:28207901-28207923 CAAAAAAATTAGCCAGAGGCCGG + Intronic
904175518 1:28625834-28625856 AAAAAAAATTAGCTGGGGCCAGG - Intronic
904193931 1:28770434-28770456 TACAAAAATTAGCTGGAGGATGG + Intergenic
904204564 1:28845186-28845208 TACAAAAATTAGCTGGGGCCAGG + Intronic
904230570 1:29067200-29067222 CAAAAAAATTAGCCGGGGCCAGG + Intronic
904685780 1:32259317-32259339 AAAAAAAAATAGCTGGAGGCTGG + Intronic
904737217 1:32643788-32643810 AAAAAAAATTAGCTGGGGCCAGG - Intronic
905074378 1:35256849-35256871 TATAAAAATTAGCTGGTGTGAGG - Intergenic
905580061 1:39077445-39077467 TACAAAAATTAGCTGGGGGGTGG - Intergenic
905590796 1:39161568-39161590 TACAAAAACTAGCCGGTGGCTGG + Intronic
906029421 1:42705913-42705935 CTTAAAAATTAGTTTGTGGCTGG - Intergenic
906307637 1:44730136-44730158 CACAAAAATTAGCTGGGCGTGGG - Intergenic
906993381 1:50763100-50763122 CAAAAAAATTAGCTGGGGCATGG + Intronic
907040168 1:51251781-51251803 CAAAAGAATTAGCTGGAGCCGGG + Intronic
907215695 1:52861910-52861932 AAAAAAAATTAGCTTCTGGCTGG + Intronic
907707038 1:56841264-56841286 TATAAAAATTAGCTGGTTGTGGG + Intergenic
907980637 1:59477341-59477363 CAGAAAGGTTAGCTGGTGCTGGG - Intronic
908035216 1:60044324-60044346 CAGAAAACTTAGTCTGTGGCTGG - Intronic
909011888 1:70343999-70344021 TTTAAAAATTAGCTGGGGGCTGG + Intronic
909308914 1:74120544-74120566 TAAAAAATTTGGCTGGTGGCTGG - Intronic
909519004 1:76545809-76545831 CAAAAAAATTAGCTGGATGTGGG - Intronic
909868862 1:80712755-80712777 CAGCAAAATAAGGTGGTGGTTGG - Intergenic
909919154 1:81358852-81358874 CAGAAGAATTACCTGGTGGTAGG + Intronic
910544242 1:88396074-88396096 CAAAAATATTAGCTGGGCGCGGG + Intergenic
910578538 1:88795168-88795190 CAAAAAAATTAGCAGGTGATAGG - Intronic
910850981 1:91649639-91649661 CAAAAAAATTAGCTGGGCGGTGG + Intergenic
911085512 1:93974124-93974146 TACAAAAATTAGCTGGGGGGTGG + Intergenic
912664099 1:111563812-111563834 CAGAAAATATAGCTGCTGGGAGG - Intronic
913103145 1:115587946-115587968 CATAAAAATTAACTGCTGACAGG - Intergenic
913272933 1:117111783-117111805 CACAAAAATTAGCTGGGTGTGGG + Exonic
915465442 1:156095081-156095103 TACAAAAATTAGCCGGTAGCCGG - Intronic
915756446 1:158265476-158265498 TACAAAAATTAGCTGGGGGTGGG + Intergenic
915998529 1:160590680-160590702 CAGACTAAGTAGCTGGTGCCTGG + Intergenic
916163060 1:161938920-161938942 CAGAAAAGTGAGCTGGTGACTGG - Intronic
916705033 1:167340584-167340606 CACAAAAATTAGCTGGGCGTGGG - Intronic
916811796 1:168312457-168312479 CCAAATAATTCGCTGGTGGCCGG + Intronic
917219835 1:172717026-172717048 TAGAAAAACAAGCTGGAGGCCGG + Intergenic
917499819 1:175576007-175576029 GGGAAAAAATAGCTGCTGGCTGG - Intronic
918057098 1:181031478-181031500 CAGAAAAAATTGCTGTTGGCCGG - Intergenic
918266261 1:182844815-182844837 CACAAAAATTAGCTGGGCGTGGG - Intronic
919245309 1:194975198-194975220 TACAAAAATTAGCTGGTTGCTGG + Intergenic
919282663 1:195511114-195511136 TACAAAAATTAGCTGGGAGCGGG - Intergenic
920063505 1:203246775-203246797 AAAAAAAATCAGCTGTTGGCAGG + Intronic
920291524 1:204926917-204926939 TATAAAAATTAGCTGGTGCACGG + Intronic
920430692 1:205916944-205916966 TACAAAAATTAGCTGGGCGCAGG + Intronic
921402513 1:214741505-214741527 CAAAAAAATTAGCTGGGACCAGG - Intergenic
921681503 1:218038107-218038129 CAAAGAAATCAGCTGGGGGCGGG - Intergenic
922089350 1:222380678-222380700 AAGCAACATCAGCTGGTGGCTGG - Intergenic
922254319 1:223879257-223879279 GAGAGAAATCAGATGGTGGCTGG - Intergenic
923305668 1:232686076-232686098 CAGAAAAGTCAGCATGTGGCTGG - Intergenic
924187976 1:241516521-241516543 CAGAAAAAATAGCTAATGCCGGG + Intronic
1063408119 10:5815482-5815504 AAAAAAAATTAGCTGGAGGCCGG + Intronic
1064406432 10:15068545-15068567 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1064427119 10:15239455-15239477 TACAAAAATTAGCTGGAGCCGGG - Intronic
1064985172 10:21202759-21202781 AAGAAAAATTAGAAGGTGGAAGG - Intergenic
1065477338 10:26154332-26154354 TAGAAAAATTAGCTGGGTGTGGG - Intronic
1067132472 10:43577049-43577071 CAGAGAAATGAGGTAGTGGCTGG - Intergenic
1067770575 10:49120700-49120722 CAGAAAAATGAGCTGGGCACAGG - Intergenic
1067846064 10:49722349-49722371 CAGAAAAATTAGCAGGACGTGGG + Intergenic
1069244380 10:66184142-66184164 TACAAAAATTAGCTGGGCGCGGG + Intronic
1070027689 10:72647994-72648016 TAGAAAATTAAGCTGCTGGCTGG + Intergenic
1070796743 10:79221375-79221397 CAGAACAAAGAGCTGGGGGCTGG - Intronic
1070804756 10:79264539-79264561 GATAAAAATTTGCTGGCGGCAGG - Intronic
1070989064 10:80715509-80715531 CAGCAGAATTGGCTGGTGGGTGG - Intergenic
1071406845 10:85343720-85343742 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1071732563 10:88263265-88263287 CAGAGAAATTATATGGTGTCTGG + Intergenic
1071901088 10:90120472-90120494 CATAAAAATTAACAGGTGGGAGG - Intergenic
1072140811 10:92587708-92587730 CAAACAAATTAGCTGGGGCCGGG - Intergenic
1074873978 10:117600277-117600299 CAAAAAACACAGCTGGTGGCAGG + Intergenic
1075698558 10:124453306-124453328 TATAAAAATTAGCTGGGCGCAGG - Intergenic
1076245124 10:128941195-128941217 TACAAAAATTAGCTAGTGGCAGG - Intergenic
1076553861 10:131308975-131308997 CAAAAATATCAGCTGGTGGGGGG - Intronic
1077100486 11:820178-820200 CAGAAAAAGTAACTCGTGGGCGG + Intronic
1078252296 11:9626155-9626177 CAAAGAAATTGGATGGTGGCTGG - Intergenic
1078572879 11:12474677-12474699 ACAAAAAATTAGCTGGTGGGTGG + Intronic
1078756136 11:14212173-14212195 CAGAATAATTAGATGGAGTCCGG + Intronic
1078811030 11:14763449-14763471 CAGAGAAATGAGATAGTGGCCGG + Intronic
1079129804 11:17740860-17740882 AAGGAAATTTACCTGGTGGCGGG + Intronic
1081326616 11:41753558-41753580 TAGAAAAATTAGCTGGGTGTAGG - Intergenic
1082639504 11:55639977-55639999 TACAAAAATTAGCTGGGCGCAGG + Intergenic
1083608458 11:63993067-63993089 CAGTAAAATCTGCTGGAGGCGGG + Intronic
1083649080 11:64190467-64190489 TACAAAAATTAGCTGCTGCCGGG - Intronic
1083680696 11:64350522-64350544 AACAAAAATTAGCTGTTAGCTGG + Intronic
1084367351 11:68710899-68710921 CTGAAAATTTCGTTGGTGGCAGG + Exonic
1085270974 11:75269563-75269585 CAGAAGCACTGGCTGGTGGCTGG - Intronic
1085511352 11:77089716-77089738 TAGAAAAATTAGCTGGGTGTTGG + Intronic
1087800005 11:102493370-102493392 CTAAAAAATTAGGTGGTGGCAGG - Intronic
1088197327 11:107289457-107289479 TACAAAAATTAGCTGGTCGTGGG - Intergenic
1088491389 11:110391396-110391418 TACAAAAATTAGCTGGGGGTGGG + Intergenic
1088638210 11:111845140-111845162 AAAAAAACTTAGTTGGTGGCTGG + Intronic
1088923252 11:114277067-114277089 CACAAAAATTAGCTGGCGTTGGG + Intronic
1088935149 11:114392239-114392261 CAAAAAAATTAGCTAAGGGCTGG + Intronic
1088981931 11:114871795-114871817 CAGAACAATGAGCTGGGGCCGGG + Intergenic
1090813774 11:130272075-130272097 CAAAAAAATTAGCTGGGTGTAGG + Intronic
1090896217 11:130977543-130977565 GAGAAAAATTAGATAGTGACTGG - Intergenic
1091349566 11:134882074-134882096 AAAAAAAATTAGCTGGTCGGTGG - Intergenic
1091857898 12:3753673-3753695 CTGGAAAATTAGGTTGTGGCCGG - Intronic
1091988101 12:4930313-4930335 CAGCAAAACTACCTTGTGGCAGG + Intronic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092463429 12:8706603-8706625 CAAAAAAATTAGCCGGACGCAGG - Intronic
1094144339 12:27213444-27213466 CATGAAAATTAGCTGTCGGCAGG - Intergenic
1094232017 12:28116642-28116664 AAGAAGAATAAGCTGGGGGCAGG + Intergenic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1094590194 12:31812527-31812549 TACAAAAATTAGCTGGTGCTTGG - Intergenic
1094715319 12:33008179-33008201 GAGGAAAAGTAGTTGGTGGCAGG - Intergenic
1096152213 12:49321823-49321845 CACAAAAATTAGCTGGTGGCAGG + Intergenic
1096247192 12:49998104-49998126 CAGAAAACTTGGATGTTGGCAGG + Intronic
1096333537 12:50735617-50735639 CACAAAAATTAGCTGGGCGTGGG - Intronic
1096428526 12:51524194-51524216 TACAAAAATTAGCTGGGCGCAGG - Intergenic
1096698234 12:53364651-53364673 CAAAAAATTTAGCCGGCGGCCGG - Intergenic
1096698799 12:53368504-53368526 AAGAAAAATTAGCTGAGTGCAGG + Intergenic
1097023891 12:56039912-56039934 TACAAAAATTAGCTGGGGCCGGG + Intergenic
1098455259 12:70665676-70665698 CAAAAATATGAGCTGGCGGCCGG - Intronic
1101179875 12:102204376-102204398 CAGAAAAATTAGATTGTAGATGG + Intergenic
1101334215 12:103781983-103782005 TAGAAAAATGGGCCGGTGGCTGG - Intronic
1101756365 12:107623661-107623683 TAGAAAAATAAGCTAGAGGCCGG - Intronic
1102002322 12:109565030-109565052 CACAAAGAGTAACTGGTGGCTGG + Intronic
1102023395 12:109699374-109699396 AAAAAAATTTAGCTGGGGGCTGG - Intergenic
1102161241 12:110770693-110770715 TACAAAAATTAGGTGGTGGCAGG + Intergenic
1102325855 12:111983140-111983162 AAAAAAAATTAGCTGGGGCCAGG + Intronic
1102449918 12:113033896-113033918 CACAAAAATTAGCTGGGTGTGGG - Intergenic
1102894789 12:116590173-116590195 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1103072711 12:117957983-117958005 CAAAAAAATTAGCTGGTGTGGGG - Intronic
1103189707 12:118990955-118990977 TACAAAAATTAGCTGGGTGCGGG - Intronic
1103538802 12:121652088-121652110 CACAAAAATTAGCTGGGCGTGGG - Intronic
1103714318 12:122935169-122935191 CAAAAAAAAGAGCAGGTGGCAGG + Intronic
1103774497 12:123356594-123356616 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1103822746 12:123711889-123711911 CAAAAAAATTAGCTGGACGCGGG + Intergenic
1104500301 12:129278775-129278797 CAGAGAAATTAGCAGGAGACAGG + Intronic
1105588189 13:21764092-21764114 CAAAAAAATTAGCCGGGGCCGGG - Intergenic
1106426256 13:29633208-29633230 TAGAAAGAGGAGCTGGTGGCTGG - Intergenic
1106528689 13:30567502-30567524 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1107279021 13:38712073-38712095 TACAAAAATTAGCTGGGGGTGGG - Intronic
1107354635 13:39553854-39553876 CAGGGAAATTGGCAGGTGGCTGG - Intronic
1108284499 13:48893200-48893222 AAAAAAAATTAATTGGTGGCCGG - Intergenic
1108540879 13:51444238-51444260 AAAAAAAATTAGCTGGGGGGTGG - Intronic
1109290344 13:60466631-60466653 TACAAAAATTAGCTGGTCGTGGG + Intronic
1109339549 13:61038389-61038411 CAGAAAATCTAGAGGGTGGCAGG + Intergenic
1109600566 13:64622385-64622407 TACAAAAATTAGCTGGTGGCAGG + Intergenic
1109953929 13:69540811-69540833 TAGAAAAATTAGCTGGTGCATGG - Intergenic
1110229997 13:73158006-73158028 CACAAAAATTAGCAGGGGGCCGG - Intergenic
1111110864 13:83707547-83707569 CAAAAAAATTAGCCGGGGGGTGG - Intergenic
1111521479 13:89410515-89410537 CAGAAAAAAAAGCTGCTGTCTGG - Intergenic
1111799992 13:92969555-92969577 CAGAAAAAGTTTCTCGTGGCAGG + Intergenic
1112224579 13:97525943-97525965 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1112242448 13:97695291-97695313 TAGAAAAATTAGCTGGGTGTGGG - Intergenic
1112306921 13:98282746-98282768 TACAAAAATTAGCTGGTGTGCGG + Intronic
1112523808 13:100123374-100123396 CAGAAAAAATCTCTGGTGGTTGG + Intronic
1112559008 13:100494990-100495012 CAGAGAAATTTGCTGGTAGGAGG + Intronic
1112609459 13:100941806-100941828 TAGAAAAATCAGCTAGTTGCAGG + Intergenic
1114774382 14:25464865-25464887 TAGAAAAATTAGCTTTTGTCTGG - Intergenic
1115162465 14:30411061-30411083 TAAAAAAATTATGTGGTGGCAGG - Intergenic
1115590061 14:34855736-34855758 CAGAAAAATTAAAAGGTAGCTGG + Intronic
1116498246 14:45588719-45588741 AAGAAAAATTGGATAGTGGCTGG + Intergenic
1116692079 14:48121016-48121038 CAGAAAAAATAGCTTGTATCCGG + Intergenic
1117120943 14:52567978-52568000 CAGATTAACTACCTGGTGGCTGG + Intronic
1117521527 14:56556423-56556445 CAGAAAATGTAGCTTGTGGATGG - Intronic
1117988585 14:61412445-61412467 CAGATAAATTAGCAGGGGCCAGG - Intronic
1118764901 14:68903386-68903408 TATAAAAATTAGCCGGTGGTGGG + Intronic
1118834089 14:69463783-69463805 AAAAAAAATTAGCTGGGGCCAGG + Intergenic
1119241579 14:73064719-73064741 CATAAAAATTAGCTGTTAACTGG + Intronic
1119270781 14:73302559-73302581 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1119315586 14:73691850-73691872 TACAAAAATTAGCTGGGGGGGGG - Intronic
1119324083 14:73748618-73748640 CAGACAAAATATGTGGTGGCAGG + Intronic
1119376059 14:74194263-74194285 CAGTAAATTTTTCTGGTGGCTGG - Intronic
1119527639 14:75334886-75334908 TAGAAAAATGAGCTGATGTCAGG + Intergenic
1119638834 14:76298485-76298507 CTCAAATATTAACTGGTGGCTGG + Intergenic
1120789478 14:88566032-88566054 CACAAAAATTAGCCGGGGGGGGG - Intronic
1121684811 14:95827884-95827906 CAGAAAATGGAGCTGGTGACTGG + Intergenic
1122163037 14:99800646-99800668 CTTAAAAATTAGCTGGGTGCAGG - Intronic
1123629266 15:22249796-22249818 TACAAATATTAGCTGGTGGTGGG + Intergenic
1124091864 15:26612960-26612982 CAAAAAAAATAGCTGGTTGTGGG + Intronic
1124097813 15:26665599-26665621 CAGAAAAAGGAGCTGGTGTCAGG + Intronic
1124649878 15:31466614-31466636 CAAAAAAATTAGCCGGGGCCAGG - Intergenic
1124700534 15:31908313-31908335 AGCAAAAATTTGCTGGTGGCCGG - Intergenic
1125178143 15:36849467-36849489 CAAGAAAATTAGCTGATGCCAGG + Intergenic
1125365636 15:38912490-38912512 AAAAAAAATTAGCTGGGCGCGGG - Intergenic
1125800674 15:42443957-42443979 TACAAAAATTAGCTGGGGGTGGG + Intronic
1126909532 15:53403059-53403081 TAGAAAAATTAGCCGGGGGCTGG + Intergenic
1126963596 15:54026565-54026587 CAGCAAAATCAGCTGGAGACTGG - Intronic
1127375518 15:58381078-58381100 TACAAAAATTAGCTGGGGGGCGG + Intronic
1127952288 15:63821256-63821278 TAAAAAAATTAGCAGGGGGCCGG + Intronic
1128718943 15:69931397-69931419 CAGTAAATTTAGCTGGTGGCTGG + Intergenic
1128808303 15:70551172-70551194 AAGAAAAATTAGGTAGTGGCCGG - Intergenic
1129096083 15:73209850-73209872 CACAAAAATTAGCTGGGCGTGGG + Intronic
1129327757 15:74810428-74810450 TTAAAAAATTAGCTGGGGGCTGG + Intergenic
1129816887 15:78563162-78563184 TAAAAAAATTAGCTGGTTGTAGG + Intergenic
1130308707 15:82734155-82734177 CAAATAAATTAGCTGGGGCCAGG + Intergenic
1130328820 15:82903838-82903860 TAGAAAAATTAGCTGGGGGCTGG + Intronic
1130616932 15:85419077-85419099 CAGAAAAATTTGGTGGTGATGGG + Intronic
1131134575 15:89923983-89924005 CACAAAAATTAGCTGGGAGTGGG + Intergenic
1131181822 15:90245318-90245340 CACAAAAATTAGCTGGGTGTGGG + Exonic
1131640553 15:94288022-94288044 CAGCAAAAGCAGCTGGTGGTAGG + Intronic
1131722168 15:95181707-95181729 CACAAAAATTAGCCGGTGTGGGG - Intergenic
1132850419 16:2022578-2022600 CATAAGAATTGGCTGTTGGCCGG - Intergenic
1133181645 16:4059230-4059252 TACAAAAATTAGCTGGTGGCGGG + Intronic
1133222934 16:4327052-4327074 TAAAAAAATCAGCCGGTGGCCGG - Intronic
1133544156 16:6788769-6788791 CAGAAAAATCAGTGGGGGGCCGG - Intronic
1133964707 16:10522147-10522169 TACAAAAATTAGCTGGGGGTGGG + Intergenic
1133999639 16:10772719-10772741 CAGAAAAATTAATAGGTGCCAGG + Intronic
1134013981 16:10875856-10875878 TAGAAAAATTAGCTGGATGTAGG + Intergenic
1134139456 16:11705047-11705069 CAGAAAAATTAGCTGGACATGGG - Intronic
1134661875 16:15990341-15990363 CTTAAAAATTTGCTGATGGCCGG - Intronic
1134795333 16:17030424-17030446 CAGAGAAAATAGCTGTTGTCTGG - Intergenic
1134816488 16:17210201-17210223 TAGAAAAATTATCTGTAGGCTGG + Intronic
1135009025 16:18856489-18856511 CAAAAAAATTAGCTGGGCGTGGG - Intronic
1135267047 16:21036168-21036190 TACAAAAATTAGCTGGGGGGTGG + Intronic
1135542955 16:23346374-23346396 TACAAAAATTAGCTGGTGGCGGG - Intronic
1135559946 16:23468626-23468648 TACAAAAATTAGCTGGTTGTGGG - Intronic
1135566835 16:23517522-23517544 GAAAAAAATTAGCTGGGGCCGGG - Intronic
1136104874 16:28022968-28022990 CAAAAAAATTAACTGGTTGTTGG - Intronic
1137740749 16:50770603-50770625 CACAAAAATTAGCTGGGCTCGGG - Intronic
1138290259 16:55840660-55840682 AAAAAAAAATAGCTGGTGGTGGG - Intergenic
1138486432 16:57347814-57347836 CAAAAAAATTAGCTGGGGCATGG + Intergenic
1139550778 16:67671825-67671847 CAAAAAAATTAGCTGGGCACTGG + Intergenic
1140707039 16:77640468-77640490 CAAAAAAATTAGCCGGGCGCAGG + Intergenic
1140715329 16:77721326-77721348 AACAAAAATTAGCCAGTGGCAGG - Intergenic
1140858836 16:79001649-79001671 AAAAAAAAGGAGCTGGTGGCAGG + Intronic
1141105142 16:81227261-81227283 AAAAAAAATTAGCTGGGGCCAGG - Intergenic
1141463642 16:84192997-84193019 CAAAAAAATTAGCTGGGCACGGG - Intronic
1142068296 16:88075048-88075070 TAAAAAAATTAGCTGGGGCCGGG + Intronic
1142732108 17:1866611-1866633 TAAAAAAATTAGCCGGTGGCCGG - Intronic
1142790469 17:2260414-2260436 CAAAAAAACTAGCTGGAAGCAGG - Intronic
1143074933 17:4333519-4333541 TACAAAAATTAGCTGGGCGCTGG + Intronic
1143349705 17:6278260-6278282 CATAAAAATAAGCTGGAGGCCGG - Intergenic
1143848087 17:9788359-9788381 TACAAAAATTAGCTGGGGGTGGG - Intronic
1145349400 17:22067461-22067483 CAAAAAAATTAGCTGGGGCCGGG + Intergenic
1145790325 17:27622620-27622642 CAGAAAAATTGTCTGGAGCCAGG - Exonic
1145937260 17:28721943-28721965 CATAAGAATTTGCTCGTGGCTGG + Intronic
1146069402 17:29666216-29666238 TACAAAAATTAGCTGGGGGCTGG + Intronic
1146070914 17:29680390-29680412 TACAAAAATTAGCTGGGTGCAGG + Intronic
1147319014 17:39634897-39634919 CAGGAAAAGCAGCAGGTGGCTGG + Intronic
1147474659 17:40699171-40699193 TTAAAAAATTAGCTGGAGGCTGG - Intronic
1147648265 17:42047325-42047347 CAAAAAAATTAGCCGGGGCCAGG - Intronic
1148504311 17:48115214-48115236 CACAAAAATTAGCTGGGCGTGGG - Intronic
1148671164 17:49411350-49411372 TACAAAAATTAGCCGGTGGTGGG - Intronic
1149114033 17:53070018-53070040 CATAATAGGTAGCTGGTGGCCGG - Intergenic
1149482171 17:57012521-57012543 AAAAAGAATTAGCTGGTGGCCGG - Intergenic
1149509098 17:57223127-57223149 CAAAAAAATTAGCCGGGCGCGGG + Intergenic
1149698212 17:58633670-58633692 CACAAAAATTAGCCGGGGGCCGG + Intronic
1149819179 17:59758527-59758549 TAGAAAAATTAGATGGGGCCAGG + Intronic
1150017523 17:61573285-61573307 TACAAAAATTAGCTGGGGGATGG - Intergenic
1150155424 17:62849165-62849187 CACAAAAATTAGCTGGGACCAGG - Intergenic
1150351217 17:64446149-64446171 TAGAAAAACTATCTGGAGGCCGG - Intergenic
1150628544 17:66859431-66859453 CAGTAAAATGTGCTGGAGGCAGG + Intronic
1151359449 17:73579820-73579842 CACAAAAATTAGCTGGGGGTTGG + Intronic
1151521092 17:74630231-74630253 CAGAAAATGCAGATGGTGGCCGG + Intergenic
1151982624 17:77522770-77522792 CAAAAAAATTAGCTGGGCGTCGG - Intergenic
1152832787 17:82508972-82508994 CAAAAAAATGAGCTGGTGGCCGG + Intergenic
1155390498 18:25330458-25330480 TTAAAAAGTTAGCTGGTGGCTGG - Intronic
1155473343 18:26213325-26213347 AAGAAGTGTTAGCTGGTGGCTGG - Intergenic
1155952378 18:31927551-31927573 AAAAAAAATTAGCTGGTAGCTGG - Intronic
1156467226 18:37355516-37355538 CACAAAAATTAGCTGGGCGCAGG + Intronic
1157150199 18:45209192-45209214 AAAAAAAATCAGGTGGTGGCAGG + Intergenic
1157216496 18:45787878-45787900 CAAAAAAATTAGCTGGGCGTCGG + Intergenic
1157420197 18:47541370-47541392 CAGAAATATCAGGTGGAGGCTGG + Intergenic
1157673151 18:49547826-49547848 TAGAACAATTAGCTGGGGGTGGG + Intergenic
1159452377 18:68618933-68618955 AAGAAAAATTAGTTGTTGCCAGG + Intergenic
1161340828 19:3741155-3741177 TACAAAAATTAGCTGGGGGCGGG - Intronic
1161554819 19:4935120-4935142 TACAAAAATTAGCTGGTGGTGGG - Intronic
1162049468 19:8023990-8024012 AATAAAAATTAGCTGGGGGTTGG + Intronic
1162050603 19:8030177-8030199 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1162104063 19:8359424-8359446 AAAAAAAATTAGCTGGGGCCCGG - Intronic
1162309615 19:9898204-9898226 TAAAAAAATTAGCTGGGGCCAGG - Intronic
1162530792 19:11235403-11235425 TACAAAAATTAGCTGGGGCCAGG - Intronic
1163316853 19:16546452-16546474 TACAAAAATTAGCTGGGGGTAGG - Intronic
1163390660 19:17027889-17027911 TATAAAAATTAGCTGGGTGCGGG - Intergenic
1163440703 19:17321284-17321306 TAGAAAAATTAGCTGGGTGTAGG - Exonic
1163512336 19:17742847-17742869 CAAAAAAATTAGCTGGGTGTGGG - Intergenic
1163718477 19:18886252-18886274 TATAAAAATTAGCTGGGGCCGGG + Intronic
1164077431 19:21833420-21833442 CAAAAAAATTAGCTGGGTGCAGG - Intronic
1164649867 19:29884011-29884033 TATAAAAATTAGCTGGAGGCTGG - Intergenic
1164770908 19:30808244-30808266 CACAAAAATTAGCTGGGCGTGGG - Intergenic
1165449814 19:35875614-35875636 TACAAAAATTAGCTGGGGCCGGG - Intronic
1165466969 19:35980452-35980474 GACAAAAATTAGCCGGAGGCCGG + Intergenic
1165583101 19:36886689-36886711 TACAAAAATTAGCTGGGGGCCGG + Intronic
1165715343 19:38041570-38041592 TACAAAAATTAGCTGGGGCCTGG - Intronic
1166394590 19:42429622-42429644 CATAAAAATTAAATGTTGGCTGG - Intronic
1166530233 19:43538238-43538260 AAAAAAATTTAGCTGGGGGCTGG - Intergenic
1166717491 19:44977707-44977729 CAGAAAAAGCAGCTGGAGACAGG + Intronic
1166757805 19:45204343-45204365 CAAAAAAATTAGCTGGGGCATGG - Intronic
1166774021 19:45301702-45301724 TACAAAAATTAGCTGGGGCCAGG + Intronic
1166978394 19:46618448-46618470 TAAAAAAATTAGCTGGGTGCTGG - Intergenic
1167151424 19:47712527-47712549 AACAAAAATTAGCTGGATGCAGG - Intergenic
1168535046 19:57162043-57162065 TAGAAAAATTAGCTGGGTGTGGG - Intronic
925180420 2:1813729-1813751 TAGAAAAATTAGCTTCCGGCCGG + Intronic
925639565 2:5974533-5974555 CAGAAAAATCACCTGGTGAAGGG - Intergenic
926058466 2:9790447-9790469 CACAAAAATTAGCTGGGGTGTGG - Intergenic
926371861 2:12186653-12186675 GAGAAAAGTGAGCTGGTAGCAGG + Intergenic
926777385 2:16435973-16435995 CAGAAAAACAGGCAGGTGGCTGG - Intergenic
927552882 2:24014306-24014328 CACAAAAATTAGCTGTAGACTGG - Intronic
927580893 2:24245774-24245796 AATAAAAAGTAGCTAGTGGCTGG - Intronic
927891906 2:26756289-26756311 TACAAAAATTAGCTGGTGGCGGG + Intergenic
928667768 2:33567715-33567737 AGGATATATTAGCTGGTGGCAGG + Intergenic
929611914 2:43277055-43277077 CAGGGAAATCAGCTGGGGGCTGG - Intronic
929986649 2:46740628-46740650 CAGAGATACCAGCTGGTGGCTGG + Intronic
930174860 2:48291560-48291582 TAGAAAACTTAACTGCTGGCCGG + Intergenic
930263355 2:49172033-49172055 GAGAAAAGTTAACTGGTTGCCGG - Intergenic
930628079 2:53720962-53720984 CAAAAAAATTAGCTGGCCACAGG + Intronic
930774791 2:55161140-55161162 GGGAAAAATTAGGTGGTGGTGGG + Intergenic
930781547 2:55228994-55229016 TATAAAAATTAGCTGGGCGCAGG + Intronic
930798896 2:55421771-55421793 TAGAAAAATTAGCCAGTGGGTGG - Intergenic
931276065 2:60744922-60744944 CAGACAACTTACCTGGTAGCAGG - Intergenic
931409122 2:62012094-62012116 CAAAAAAATTAGCTGGGGCTGGG + Intronic
931469784 2:62527116-62527138 CAGAAATATGAGCTCGTGGCTGG - Intergenic
931762495 2:65430871-65430893 AAAAAAAAGTGGCTGGTGGCGGG + Intronic
932235178 2:70115157-70115179 TAGAAAAAGTAACTTGTGGCTGG + Intergenic
932282903 2:70509985-70510007 GAGAAACATTAGCTGGAGGCAGG - Intronic
932456915 2:71855729-71855751 GAGATAAAATATCTGGTGGCTGG - Intergenic
933281085 2:80333604-80333626 AAGAAAAAAAAGGTGGTGGCTGG - Intronic
934668282 2:96189406-96189428 CATAAATCTTAGCTGGGGGCTGG + Intronic
935040029 2:99417293-99417315 AAAAAAAATTAGCTGGGGGTAGG - Intronic
936592376 2:113816477-113816499 CAGATAAAATAACTGGAGGCTGG + Intergenic
936704840 2:115059714-115059736 AAGAAAAATAAGCTGATGGCGGG + Intronic
937948154 2:127360901-127360923 GAGAAAAATTAGGTGGCTGCAGG + Intronic
940395045 2:153179037-153179059 CAGAAAAATGGGATTGTGGCTGG - Intergenic
940473864 2:154134835-154134857 TACAAAAATTAGCTGGTGACGGG + Intronic
940663528 2:156577183-156577205 CAGAAAAATCAACTGATGGCTGG + Intronic
941073667 2:160983616-160983638 CAGATAAATTAGCAGTTGCCAGG + Intergenic
941219782 2:162762528-162762550 CACAAACTTTAGCTGGTGACTGG + Intronic
942026400 2:171914820-171914842 TAAAAAAATTAGCTGGGGCCAGG + Intronic
942084302 2:172429212-172429234 CACAGAAATTAGCTGGGGGTGGG + Intronic
942086747 2:172450998-172451020 CACAAAAATTAGCTGGACGTGGG + Intronic
942344431 2:174987588-174987610 TACAAAAATTAGCTGGTGGCGGG - Intronic
942475316 2:176313546-176313568 CACAAAAATTAGCTGGGTGGTGG - Intronic
942645172 2:178102568-178102590 AAAATAAATTAGCTGATGGCTGG - Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
943328995 2:186536476-186536498 CAGAAAAATGAGATGGTGACTGG + Intergenic
944352142 2:198741867-198741889 TACAAAAATTAGCCAGTGGCAGG - Intergenic
944865829 2:203860705-203860727 TAGAAAAATTAGCTGGGCGTGGG - Intergenic
946218750 2:218207901-218207923 CAAAAAAATTAGCTGGGGTGTGG + Intergenic
946718482 2:222578682-222578704 CAAAAAAATTAGCTGGGGCCGGG + Intronic
946912279 2:224476170-224476192 TACAAAAATTAGCTGGTGGTGGG - Intronic
947377580 2:229512226-229512248 CACAAAAATTAGCTGGGTGTGGG + Intronic
947495697 2:230634821-230634843 TACAAAAATTAGCTGGGGGATGG + Intergenic
947634165 2:231671776-231671798 CAGAAAAATTACATGCTGGCTGG - Intergenic
947802966 2:232943262-232943284 CAGAAAACTCAGCTGGTGACAGG - Intronic
948490692 2:238310723-238310745 AATAAAAATTAGCTGATGGCCGG + Intergenic
948959645 2:241323160-241323182 AAAAAAAATTAGATGGTGGCTGG - Intronic
1169121272 20:3097434-3097456 AAAAAAAATTAGCTGGTGGCCGG - Intergenic
1169121320 20:3097747-3097769 TTTAAAAATTAGCTGGTGGCAGG - Intergenic
1169814840 20:9645738-9645760 CAGAAAAATTAGCTTGGGCATGG - Intronic
1169969515 20:11254359-11254381 AAGAAAAATTATTTGTTGGCTGG - Intergenic
1170244653 20:14207250-14207272 CACAAAAATTAGCTGGGCGTAGG - Intronic
1170588025 20:17750281-17750303 GAGAAAAATTCGCTCGTGACTGG + Intergenic
1170936385 20:20813602-20813624 CAGAAAAATTATATGCTGGCTGG - Intergenic
1171484388 20:25476781-25476803 CCGAAAGATGGGCTGGTGGCAGG - Exonic
1171559306 20:26108467-26108489 CCAAAAAATTAGCTGGGGCCGGG + Intergenic
1172576371 20:36012001-36012023 TACAAAAATTAGCTGGGGCCAGG + Intronic
1172759648 20:37313220-37313242 CATAAAAATTAGCCAGTAGCGGG + Intronic
1172925822 20:38533982-38534004 TACAAAAATTAGCTGGGGGTGGG + Intronic
1173530080 20:43762554-43762576 AATAAAAATTAGCAGGTGACCGG - Intergenic
1173531817 20:43775480-43775502 TACAAAAATTAGCTGGTTGGTGG + Intergenic
1173613242 20:44386145-44386167 AAAAAAAATCAGATGGTGGCTGG - Intronic
1173882088 20:46423112-46423134 CAAGAAAATTAGCTGGGGGAAGG - Intronic
1174147109 20:48459662-48459684 AAGAAAAATCACCTGGGGGCCGG - Intergenic
1174320059 20:49734560-49734582 AAAAAAAAAAAGCTGGTGGCGGG + Intergenic
1174331240 20:49820333-49820355 CAAAAAAATTAGCTGGGTGTGGG + Intronic
1174446396 20:50593972-50593994 CAGAAAAATGCTCTGGCGGCCGG + Intronic
1175254568 20:57632348-57632370 CAGAAAGAATAGATGGTAGCCGG + Intergenic
1176516779 21:7790272-7790294 TAGAAAAATCAACTGTTGGCCGG + Intergenic
1176907891 21:14526018-14526040 CAAAAAAATTAGCTGGGCGTGGG - Intronic
1178456073 21:32752789-32752811 TACAAAAATTAGCTGGTGGCGGG - Intronic
1178565425 21:33679850-33679872 CAAAAAAATTAGCTGGATGTGGG - Intronic
1178650807 21:34420284-34420306 TAGAAAAATCAACTGTTGGCCGG + Intronic
1179250308 21:39666446-39666468 TACAAAAATTAGCTGGTTGGTGG - Exonic
1179507073 21:41848421-41848443 CAGAAAAATGCCCTGCTGGCAGG - Intronic
1180627279 22:17202419-17202441 TACAAAAATTAGCTGTTGGCCGG - Intronic
1180925397 22:19550272-19550294 TATAAAAATTAGCTGGGGCCAGG - Intergenic
1181480996 22:23198965-23198987 CACAAAAATTAGCTGGACGTGGG + Intronic
1181873993 22:25925606-25925628 CAGAAACTTGAGCAGGTGGCTGG + Intronic
1182619758 22:31612564-31612586 CAGAAAAATTAGCTGGGTGTAGG + Intronic
1182631693 22:31690934-31690956 AAAAAAAATTAGCTGGAGGCCGG - Intronic
1182819478 22:33202789-33202811 CAGAAAAATCAGCAGGTCTCTGG - Intronic
1183195318 22:36349710-36349732 CAGAAAAACAAGCTGATAGCAGG + Intronic
1183307538 22:37090680-37090702 AGGAAAGATTAGGTGGTGGCTGG - Intronic
1183835330 22:40448014-40448036 CAAAAAAATTAGCTGGGGCTGGG + Intronic
1183934088 22:41252175-41252197 TACAAAAATTAGCTGGGCGCGGG + Intronic
1184216769 22:43072775-43072797 CAAAAAAATTAGCTGGGTGGTGG - Intronic
1184711596 22:46253566-46253588 TAGAAAAATTAGCTGGGCGTTGG + Intergenic
1184763881 22:46561729-46561751 CAGGACCAATAGCTGGTGGCAGG + Intergenic
1184796130 22:46733885-46733907 TACAAAAATTAGCTGGTGGCAGG + Intronic
1185251806 22:49806039-49806061 CATAAAAATTAGCTGGGTGTGGG - Intronic
1185381767 22:50511940-50511962 TACAAAAATTAGCTGGGGCCAGG - Intronic
949153068 3:793815-793837 CAAAAAAATTAGCTGGGTTCGGG + Intergenic
949502323 3:4692822-4692844 CATAAAAATAAGATGGAGGCAGG + Intronic
950272294 3:11627423-11627445 AAGAAAAATTAGCTGGGCGTGGG + Intronic
952845169 3:37682145-37682167 CAGAGAAATTGGATGGTAGCTGG - Intronic
952930207 3:38354220-38354242 TACAAAAATTAGCCAGTGGCGGG - Intronic
953976990 3:47389457-47389479 AATAAAAATTAGCTGGGGCCAGG + Intronic
954062427 3:48079497-48079519 TACAAAAATTAGCTGGGGCCTGG + Intronic
954203497 3:49039905-49039927 CAAAAAAATTAGCTGGGCGTGGG + Intronic
954382799 3:50228397-50228419 CAAAAAAATTAGCTGGGCGTGGG + Intronic
954912745 3:54122542-54122564 CAGAAAAAGGAGCGGGTGGGGGG - Intronic
955403030 3:58607119-58607141 CAGAAAACTTACCAGGAGGCTGG - Intronic
956533279 3:70245808-70245830 CAAAAAAATTGGATGGTGACAGG - Intergenic
956774207 3:72551443-72551465 TTAAAAAATTAGCTGGAGGCTGG + Intergenic
957307668 3:78479284-78479306 AAGAAAAATAAGGTGGAGGCAGG - Intergenic
959213922 3:103424974-103424996 CAGCATAACTGGCTGGTGGCAGG - Intergenic
959393889 3:105811856-105811878 TACAAAAATTAGCCAGTGGCAGG - Intronic
959510606 3:107207262-107207284 CAGAAAAATTATTTGTTGGAAGG - Intergenic
960091238 3:113640984-113641006 TACAAAAATTAGCTGGGGGGTGG - Intergenic
960103659 3:113770938-113770960 CAAAAAAATTAGCTGGGTGTGGG + Intronic
960911618 3:122654854-122654876 CAAAAAAATTAGCTGGGGCATGG + Intergenic
961326322 3:126111514-126111536 CAGAAACATGAGCTGAGGGCAGG + Intronic
961338384 3:126199762-126199784 TACAAAAATTAGCTGGGGGCGGG + Intergenic
964060235 3:152513125-152513147 CAAAAAAATTAGCTGGGCGTGGG + Intergenic
964250489 3:154710821-154710843 CAGAGAAAATAGCTACTGGCTGG - Intergenic
964311412 3:155397253-155397275 CAAAAAAATTAGCTGGGCGTGGG + Intronic
965824088 3:172713162-172713184 CATAAAGATTAGCTTCTGGCTGG - Intergenic
966384187 3:179377909-179377931 AAAAAAAATTAGCCGGTGGCAGG + Intronic
967053437 3:185805927-185805949 TACAAAAATTAGCTGGGGGTGGG - Intronic
967179606 3:186892304-186892326 CAGAAGTATTTGCTGGTGGGAGG + Intergenic
967457322 3:189703277-189703299 TAGAAAAATTAGCTGGTCGTGGG + Intronic
967573211 3:191056063-191056085 AAGTGAATTTAGCTGGTGGCAGG - Intergenic
967605686 3:191442921-191442943 CAGGACAATTAGATGATGGCTGG + Intergenic
967935400 3:194723626-194723648 TACAAAAATTAGCTGGTGGTGGG + Intergenic
968261160 3:197325230-197325252 CAGAAAAAATAGCACATGGCCGG + Intergenic
968785641 4:2620550-2620572 AAGAATAATTAGCAAGTGGCAGG + Intronic
969861837 4:10042143-10042165 CAAAAAAATTAGCTGGGTGGTGG + Intronic
970252773 4:14134005-14134027 CACAAAAATTAGCTGGGTGTGGG - Intergenic
970261698 4:14231502-14231524 CACAAAAATTAGCTGGGTGTGGG - Intergenic
971074928 4:23137029-23137051 AAGAAATACTAGCTGGTGTCTGG + Intergenic
971508678 4:27396727-27396749 CAAAAAAATTACGTGGTGGTGGG - Intergenic
972470135 4:39396124-39396146 TACAAAAATTACCTGGAGGCCGG - Intergenic
972476532 4:39455533-39455555 CTTAAAAATTAGCTGGGGCCAGG + Intronic
973185475 4:47322814-47322836 TACAAAAATTAGCTGGGTGCTGG + Intronic
973267166 4:48222131-48222153 AAGATAAAATAGATGGTGGCTGG + Intronic
974157892 4:58098045-58098067 CAGAAATAGGAGCTGTTGGCAGG - Intergenic
974365409 4:60941910-60941932 TAAAAAAATCATCTGGTGGCGGG + Intergenic
974383832 4:61178614-61178636 AAGAAAAATAAGGTGGTAGCTGG - Intergenic
974875551 4:67699755-67699777 CAAAAAAATTAGCTGGGCGTAGG - Intronic
976241939 4:82967071-82967093 TAGAAAAATTAGCTGGGTGGTGG + Intronic
976639344 4:87321182-87321204 TACAAAAATTAGCTGGGTGCGGG - Intronic
977027308 4:91835052-91835074 CAGAACACTTAGGTGGTGGGAGG + Intergenic
977144694 4:93423499-93423521 CAAAAAAATTAGCTGGGCGTGGG - Intronic
977540416 4:98312224-98312246 CAGAATTATTAGCTGGAGACTGG - Intronic
977563867 4:98561921-98561943 CAGGAAGATTAGCTGTGGGCAGG + Intronic
978427000 4:108593518-108593540 TACAAAAATTAGCTGGTGGCCGG - Intergenic
980058678 4:128104739-128104761 TAGAAAAATTAACTGTTGCCGGG - Intronic
980387687 4:132107592-132107614 CAAAAAAAGTAGGAGGTGGCGGG + Intergenic
980797552 4:137703975-137703997 TAAAAAAATTAGCCGGTGGCGGG - Intergenic
980913014 4:139010481-139010503 CAGATAAATAAACTGGGGGCAGG - Intergenic
982261774 4:153500255-153500277 TATAAAAATTAGCTGGGGGTGGG - Intronic
982739362 4:159041721-159041743 CAGAAAATTAAACTGGTGGGAGG - Intergenic
983556970 4:169067834-169067856 CAAAAAAATTAGCCGGGGCCGGG + Intergenic
983778361 4:171637519-171637541 CACAAAAATTAGCTGGAGAGTGG - Intergenic
984350638 4:178587812-178587834 TTTAAAAATTAGCTGGGGGCCGG + Intergenic
984471141 4:180175875-180175897 CAGAAAAATCAGCTGGGAGTGGG + Intergenic
984666782 4:182437494-182437516 CAAAAAAAATAGCTGATGGCTGG + Intronic
985268524 4:188172957-188172979 TTTAAAAATTAGCTGGAGGCTGG + Intergenic
985353237 4:189089419-189089441 TACAGAAATTACCTGGTGGCAGG + Intergenic
987029219 5:13960604-13960626 CAGAAAAATTCGCTGGCCTCTGG + Intergenic
987198061 5:15547320-15547342 CAGACAACTGAGCTGGTGTCTGG + Intronic
987970026 5:24930537-24930559 CAGAAAAATTCTGTGGTTGCAGG + Intergenic
988055972 5:26097244-26097266 CAGAAAAGTTTGCTGGAGTCTGG - Intergenic
989016625 5:36942583-36942605 TAAAAAAATTAGCTGGGGGGTGG + Intronic
989050417 5:37314680-37314702 ATAAAAAATTAGCTGGTGGGGGG + Intronic
989183911 5:38604550-38604572 TACAAAAATTAGCTGGTGGTGGG + Intronic
991006681 5:61834690-61834712 CAGGAAAATTAGCAGATGGATGG + Intergenic
991063379 5:62401339-62401361 TACAAAAATTAGCTGGTGTGGGG + Intronic
991360778 5:65817982-65818004 AAGAAAAATCAGCTGTTGGGTGG - Intronic
991602579 5:68368224-68368246 CAGAAAAATGAGCTGGTTGACGG + Intergenic
992208591 5:74455098-74455120 CACAAGAATTAGCTGGTGCGTGG + Intergenic
992581851 5:78186395-78186417 CAGAAAGATTAGCAGTTGCCAGG + Intronic
992777879 5:80104113-80104135 CAGAAAAATTGTTTGTTGGCTGG - Intergenic
992880708 5:81106526-81106548 CAGAGAAATCAGTTGGAGGCAGG - Intronic
993602363 5:89943293-89943315 CAGAAAATTTAGCTGCAGACGGG + Intergenic
993648898 5:90494005-90494027 CTAAAAAATTAGATAGTGGCTGG - Intronic
994737055 5:103568377-103568399 TACAAACATTAGCTGGAGGCTGG + Intergenic
997221093 5:132165084-132165106 CAGAATAAGTAGGTGGTGGCGGG - Intergenic
997384751 5:133463871-133463893 CAGCAAAGTTAGGTGGAGGCTGG + Intronic
998779433 5:145640188-145640210 CAAAAAAATTGGCCGGCGGCCGG + Intronic
999330348 5:150669799-150669821 TAGAAAAATTAGCTGGGCGTAGG - Intronic
999749185 5:154613884-154613906 TACAAAAATTAGCTGGTGTGGGG + Intergenic
1000340943 5:160276937-160276959 CACAAAAATTAGCTGGGTGTTGG - Intronic
1000440437 5:161256845-161256867 CAGAAAAAGTGGGAGGTGGCTGG - Intergenic
1000766258 5:165294210-165294232 CAAAAAAATTAGCTGGGCGTTGG + Intergenic
1000778192 5:165445062-165445084 TACAAAAATTAGCTGGGAGCTGG + Intergenic
1001065662 5:168533188-168533210 TACAAAAAATAGCTGGTGGCGGG + Intergenic
1001578425 5:172780762-172780784 CAAAAAAATTAGCTGGGTGTGGG + Intergenic
1001920883 5:175598454-175598476 TACAAAACATAGCTGGTGGCAGG + Intergenic
1002806225 6:577066-577088 CAGCAAAATTGGGTGGTGGTGGG + Intronic
1003368068 6:5496062-5496084 TAGAAGAATTAGCTGGGGGTGGG - Intronic
1004592234 6:17063776-17063798 CAGAAGAATTATTTGGTGGAGGG + Intergenic
1004700388 6:18073884-18073906 CAAAAAAATTAGCTAGTGAGGGG + Intergenic
1005011045 6:21336086-21336108 TAGAAAAATTAAATGCTGGCCGG + Intergenic
1005024675 6:21450967-21450989 CAGGGAAACTAACTGGTGGCAGG - Intergenic
1005248853 6:23920708-23920730 CAGAAAGATCAGCTGGGGTCAGG + Intergenic
1005580265 6:27227553-27227575 CAAAAAAATTAGCCGGTATCCGG - Intergenic
1005767571 6:29028471-29028493 CAGCAGAATTAGCTGGGCGCTGG + Intergenic
1006013803 6:31064727-31064749 TACAAAAATTAGCTGGGCGCTGG + Intergenic
1007211922 6:40199515-40199537 CAAAAAAATTAGCTGGGGCGTGG - Intergenic
1007488091 6:42196371-42196393 TACAAAAATTAGCTGGCTGCTGG - Intergenic
1007569898 6:42882055-42882077 TACAAAAATCAGCCGGTGGCCGG - Intronic
1007957669 6:45932261-45932283 TACAAAAATTAGCTGGTCGTGGG - Intronic
1007978951 6:46130408-46130430 AAGAAAAATTAGCAGGTGCTGGG + Intronic
1007988965 6:46234998-46235020 CAGAGAAATGTGTTGGTGGCTGG + Intronic
1008594505 6:53027849-53027871 CACAAAAATTAGCCGGGCGCCGG + Intronic
1008797520 6:55322096-55322118 TACAAAAATTAGCAGGTAGCGGG - Intergenic
1009824642 6:68851160-68851182 AAGAAAAATTAACTGGTATCAGG - Intronic
1010455371 6:76048713-76048735 CAGAAAAATGAGCTAGTATCTGG - Intronic
1010860032 6:80899347-80899369 CAGAAAACATGGCTGGGGGCGGG + Intergenic
1010870857 6:81036178-81036200 CATAAAAATTAGATCGTAGCTGG - Intergenic
1011023701 6:82842818-82842840 TATAAAAGTTAGCTGTTGGCTGG + Intergenic
1012238770 6:96848920-96848942 TACAAAAATTAGCTGGGGGCCGG + Intergenic
1013240299 6:108239053-108239075 CAAAAAAATTAGCTGGGTGTGGG - Intronic
1013740076 6:113273005-113273027 AAGAAAAATTACATGGTGGGAGG - Intergenic
1015538829 6:134294690-134294712 TACAAAAATTAGCTGGTTGGGGG - Intronic
1015612883 6:135044922-135044944 CAGAAAAAATAGCTCCTGGCAGG - Intronic
1015748719 6:136538628-136538650 AAAAAAAATTAGCTGGTGCTAGG + Intronic
1016053784 6:139557416-139557438 TACAAAAATTAGCTGGTGTTGGG - Intergenic
1017409607 6:154154038-154154060 TAGAAATATTTGGTGGTGGCAGG + Intronic
1017430542 6:154366407-154366429 CAAAAAAATTAGCTGGGCGTGGG - Intronic
1017729899 6:157305958-157305980 CAGATAAATGGGCTGGTAGCTGG + Intronic
1017982211 6:159409593-159409615 TACAAAAATTAGCTGGGTGCGGG + Intergenic
1019554718 7:1623257-1623279 AAAAAAAATTAGCTGGGGGTTGG + Intergenic
1019680104 7:2342945-2342967 CAAAAAAATTAGCCGGTGGTGGG - Intronic
1020122225 7:5511280-5511302 CAAAAAAATTAGCCAGGGGCCGG + Intronic
1020941873 7:14549661-14549683 CAGAAAAGTTATCTGGTGAAAGG + Intronic
1021167633 7:17360234-17360256 CAGATAAATGACCTGATGGCGGG - Intergenic
1021384222 7:20008293-20008315 CATAAAAATTAGCTAGATGCAGG - Intergenic
1021821311 7:24500438-24500460 CAAAAAAATTAGCTGGGTGTAGG - Intergenic
1022302976 7:29119045-29119067 CAGAAAAATGGGGTAGTGGCTGG - Intronic
1022410996 7:30138267-30138289 TAGAAAAATTAGCTGGGCGTGGG - Intronic
1023053374 7:36272667-36272689 GCTAATAATTAGCTGGTGGCGGG + Intronic
1023198688 7:37669567-37669589 CAGTAAAATTAGCTGGATGGTGG + Intergenic
1023258727 7:38337091-38337113 CAAAAAAATTAGCCGGTTGTGGG + Intergenic
1024593954 7:50916778-50916800 CACAAAAATTAGCTGGGTGTGGG - Intergenic
1025116252 7:56260928-56260950 TAGAAAAATTAGCTGGGTGGTGG + Intergenic
1025132551 7:56384074-56384096 TAGAAAAATTAGCTGGGCGTGGG - Intergenic
1025651365 7:63472630-63472652 CAAAAAAATTAGCTGGGTGGTGG + Intergenic
1027040633 7:74959046-74959068 CAAAAAAAATAGCTGTTGTCTGG - Intergenic
1027040689 7:74959353-74959375 AATAAAAAATAGCTGTTGGCTGG - Intergenic
1027082947 7:75243004-75243026 AATAAAAAATAGCTGTTGGCTGG + Intergenic
1027083003 7:75243311-75243333 CAAAAAAAATAGCTGTTGTCTGG + Intergenic
1027397808 7:77774431-77774453 TACAAAAATTAGCTGGGGCCAGG + Intronic
1027489470 7:78804911-78804933 TACAAAAATTAGCTGGGTGCGGG + Intronic
1028131507 7:87181002-87181024 CAGAAAAATTAGCTGGTGGCAGG - Intronic
1029185607 7:98736313-98736335 CAGCTAAATTAGCTTGTGGCAGG + Intergenic
1029314576 7:99699752-99699774 CACCAAAATTAGAAGGTGGCTGG + Intronic
1030003991 7:105097208-105097230 CAGAAAAGTCATCTGGTGACAGG + Intronic
1030219948 7:107088124-107088146 CAGAGAAATTAACTGGTAGAAGG + Intronic
1030281207 7:107777439-107777461 TACAAAAATTAGCCAGTGGCAGG + Intronic
1030336767 7:108337107-108337129 CAGAAAAATTAGCTGGGCTGGGG + Intronic
1030958754 7:115888853-115888875 AAGAGAAATTACTTGGTGGCTGG + Intergenic
1031021200 7:116629804-116629826 TAGAAAAATTAGCTGGGTGTGGG + Intergenic
1032258874 7:130318563-130318585 TACAAAAATTAGCTGGGGGTGGG - Intronic
1032356924 7:131219916-131219938 TAGAGAAACTAGCAGGTGGCAGG - Intronic
1033309698 7:140251970-140251992 CACAAAAATTAGCCAGGGGCTGG - Intergenic
1033673753 7:143517930-143517952 CATCAAAATTATCTGGTGGAGGG + Intergenic
1034624466 7:152482026-152482048 AAGAAAACTTAGCTGGGGGCTGG + Intergenic
1034761132 7:153672935-153672957 CAAAAAAATTAGCTGGGGCATGG - Intergenic
1035089374 7:156294074-156294096 CAGTAAAATGCCCTGGTGGCTGG - Intergenic
1035140965 7:156760284-156760306 GAGAAAAATTAGCTTGGGGAAGG + Intronic
1035660220 8:1342103-1342125 CAGAAAAATCAGCTGGGGGTAGG - Intergenic
1036526494 8:9539688-9539710 TAGAAAAATTAGCTGGGGCCTGG - Intergenic
1039512709 8:38104833-38104855 CATCAACAGTAGCTGGTGGCTGG - Intergenic
1039535568 8:38309169-38309191 CCAAAAAACTAGCTGGAGGCTGG + Intronic
1039809093 8:41028674-41028696 TACAAAAATTAGCTGGTGGTGGG - Intergenic
1040991395 8:53353989-53354011 TACAAAAATTAGCTGGTGGTGGG + Intergenic
1041716107 8:60933801-60933823 CAGCAGACTTGGCTGGTGGCTGG + Intergenic
1042656867 8:71108807-71108829 GATAAAAATTAGGTGGTGGTGGG - Intergenic
1043419789 8:80086717-80086739 TACAAAAATTAGCTGGTTGGGGG + Intronic
1043498549 8:80830170-80830192 CAGAGAAATAGGGTGGTGGCTGG + Intronic
1045731539 8:105247645-105247667 TATAAAAATTAGCTGGTTGTGGG + Intronic
1046088793 8:109473213-109473235 CAGAAAACTTCACTGGAGGCTGG + Intronic
1046461075 8:114536849-114536871 CACAAAAATTAGCTGGGTGTGGG - Intergenic
1046839955 8:118844987-118845009 ACAAAAAATTAGCTGGTGGCGGG + Intergenic
1046996682 8:120531546-120531568 CACAAAAATTAGGAGGGGGCGGG + Intronic
1047329615 8:123874870-123874892 CAGAGAAATGAGATGGTAGCTGG - Intronic
1047517921 8:125571012-125571034 CACAAAAATTAGCTGGGGGCGGG - Intergenic
1047938253 8:129802692-129802714 TAGAAAAATTAGCTGGGTGTAGG + Intergenic
1048243296 8:132765935-132765957 TACAAAAATTAGCTGGTGGCGGG - Intergenic
1049969440 9:808468-808490 CAAAAAAATTAGCTGGGCGTGGG + Intergenic
1050262163 9:3851988-3852010 CAAAAAAATTAGCTGGATGTGGG + Intronic
1051275651 9:15395444-15395466 TAAAAAAATTAGCTGGGGCCAGG + Intergenic
1051569281 9:18537567-18537589 TACAAAAATTAGCTGCTGGATGG + Intronic
1052353428 9:27480593-27480615 TACAAAAATTAGCTGGGGCCAGG - Intronic
1053375212 9:37600374-37600396 CAGAATAAATAGGAGGTGGCCGG - Intronic
1053402197 9:37835281-37835303 AAAAAAAATTAGCTGGGGCCGGG + Intronic
1053811772 9:41860549-41860571 AAAAAAAATTAGCTGGGCGCGGG + Intergenic
1054618823 9:67326890-67326912 AAAAAAAATTAGCTGGGCGCGGG - Intergenic
1055036425 9:71823166-71823188 CAGAATAATTAGATGGGGCCAGG - Intergenic
1055578470 9:77683258-77683280 CAAAAAAATTAGCTGGATGTGGG + Intergenic
1056217206 9:84416289-84416311 CACAAAAATTAGCTGGGTGTGGG + Intergenic
1056780785 9:89548778-89548800 CAGAAAAATTAGCTGGGTGTGGG + Intergenic
1057406934 9:94780864-94780886 TGGAAAAATCAGCTGGTGCCCGG - Intronic
1057535279 9:95896576-95896598 TAGAAAAATTAGCTGGGCACAGG - Intronic
1057773530 9:97986115-97986137 TTGAAAAATGAACTGGTGGCCGG - Intronic
1058454120 9:105123451-105123473 ACAAAAAATTAGCTGGAGGCTGG - Intergenic
1059114706 9:111590653-111590675 CAGAAAAATTACATGAAGGCTGG - Intronic
1059599500 9:115761037-115761059 CAGAGATATTAGCTGGTGGGGGG + Intergenic
1060674407 9:125499713-125499735 CAGAAAAACTAATTTGTGGCTGG + Intronic
1061113581 9:128593135-128593157 CAGAAAGATGAGGTGGTGGGAGG + Intronic
1061573011 9:131489337-131489359 TACAAAAATTAGCCGGTGGGTGG - Intronic
1061837613 9:133339962-133339984 CAGAAAATGAAGCTGATGGCAGG + Exonic
1062179068 9:135180989-135181011 CAAGAAAATTAGCAGGTGCCTGG + Intergenic
1185580381 X:1207408-1207430 CAAAAAAATTAGCCGGGCGCGGG - Intronic
1185718090 X:2359523-2359545 CAAAAAAATTAGCTGGGCGTGGG + Intronic
1186090812 X:6047321-6047343 CACAAAAATTAGCTGGTCGTGGG + Intronic
1186769209 X:12801124-12801146 CAAAACAAGTGGCTGGTGGCTGG + Intronic
1186799625 X:13079739-13079761 AAAAAAAATTAGCCGGTGGTGGG - Intergenic
1187196134 X:17086464-17086486 CATAAAAATTGGCAAGTGGCCGG - Intronic
1187997830 X:24947565-24947587 TAGAAAAATCTGCAGGTGGCTGG - Intronic
1188034309 X:25299472-25299494 CAGAAAGATTAGTTGGTTGTCGG + Intergenic
1188490792 X:30737219-30737241 TACAAAAATTAGCTGGGTGCAGG - Intergenic
1189433563 X:40970935-40970957 AAAAAAAATTAGCTGGGGCCGGG - Intergenic
1190292467 X:49001746-49001768 CAGAACCATTAGCGGGTGGGAGG - Intronic
1190534461 X:51411894-51411916 CAGGAAGTGTAGCTGGTGGCTGG + Intergenic
1190749883 X:53352898-53352920 TACAAAAATTAGCTGGGTGCGGG - Intergenic
1191674982 X:63784642-63784664 CAGAAAATCTAGTTGGGGGCAGG + Intronic
1191976874 X:66882339-66882361 CAGATAAATTAGCTGATGAATGG + Intergenic
1192314301 X:70040056-70040078 CTGCAAAATGAGCTGGAGGCTGG - Intergenic
1192416486 X:70985607-70985629 TACAAAAATTAGCTGGGTGCAGG + Intergenic
1192734388 X:73834829-73834851 TACAAACATTAGCTGGGGGCGGG + Intergenic
1192814034 X:74572718-74572740 CACAAAAATTAGCCAGTGGCGGG - Intergenic
1192921586 X:75712981-75713003 AAGGAAAATTAGATGGTGGGTGG + Intergenic
1194020800 X:88690157-88690179 CAAAAAAATTAGCTGGGTGTGGG - Intergenic
1195683144 X:107563707-107563729 CATAAAAAATAGGTGGTGGGTGG + Intronic
1195758329 X:108220947-108220969 TACAAAAATTAGCTGGTGGCAGG + Intronic
1196243798 X:113374433-113374455 CAAAAAAATTAGCCGGTGGCGGG - Intergenic
1196813676 X:119647947-119647969 AAAAAAAATTAACTAGTGGCCGG - Intronic
1197237308 X:124081842-124081864 TAGAAAAATTAGCTGGGAGTGGG + Intronic
1197695517 X:129545863-129545885 AAAAAAAATTAGCTGGGGGGTGG - Intronic
1197780982 X:130159974-130159996 TAGAAAAATTAGCTGGGCGTTGG - Intronic
1197855597 X:130910799-130910821 CAAAAAAATTAGCTGGGCGTGGG - Intergenic
1198007695 X:132515479-132515501 CAGAAAAATTAGTGGTTGCCAGG + Intergenic
1198098540 X:133403849-133403871 CACAAAAATTAGCTGGGGTGTGG - Intronic
1198156988 X:133970706-133970728 CAAAAAAATGAGCTGGGGGGTGG + Intronic
1198198733 X:134392950-134392972 CAAAAAAATTAGCTGGGGTGTGG - Intronic
1198594325 X:138219840-138219862 CAAAAAAAATTGCTGGTGACTGG + Intergenic
1199582317 X:149372746-149372768 CTGAAAATATAGCTGGAGGCTGG + Intergenic
1199590907 X:149467789-149467811 CAGCAAAACTAGCTGGTGCAGGG + Intergenic
1200769823 Y:7113295-7113317 CACAAAAATTAGCCGGGTGCCGG + Intergenic
1201731285 Y:17206456-17206478 ACAAACAATTAGCTGGTGGCAGG - Intergenic
1201737553 Y:17285591-17285613 TAGAAAAATTAGTTTGTGTCAGG - Intergenic