ID: 1028132508

View in Genome Browser
Species Human (GRCh38)
Location 7:87192868-87192890
Sequence TGTAGCACGTAAAAACTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 56
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 49}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028132508_1028132512 -5 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132512 7:87192886-87192908 CTACAAAGAAAGAAAAAGAGGGG 0: 1
1: 1
2: 11
3: 285
4: 2570
1028132508_1028132513 2 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132513 7:87192893-87192915 GAAAGAAAAAGAGGGGTGATTGG 0: 1
1: 0
2: 17
3: 144
4: 1956
1028132508_1028132517 24 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132517 7:87192915-87192937 GGTGTTGTGGGTTACTGCACTGG 0: 1
1: 0
2: 0
3: 5
4: 120
1028132508_1028132515 11 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132515 7:87192902-87192924 AGAGGGGTGATTGGGTGTTGTGG 0: 1
1: 1
2: 5
3: 31
4: 414
1028132508_1028132510 -7 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132510 7:87192884-87192906 TGCTACAAAGAAAGAAAAAGAGG 0: 1
1: 0
2: 8
3: 111
4: 1377
1028132508_1028132514 3 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132514 7:87192894-87192916 AAAGAAAAAGAGGGGTGATTGGG 0: 1
1: 0
2: 6
3: 70
4: 825
1028132508_1028132516 12 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132516 7:87192903-87192925 GAGGGGTGATTGGGTGTTGTGGG 0: 1
1: 0
2: 1
3: 18
4: 298
1028132508_1028132511 -6 Left 1028132508 7:87192868-87192890 CCTGCCAGTTTTTACGTGCTACA 0: 1
1: 0
2: 0
3: 6
4: 49
Right 1028132511 7:87192885-87192907 GCTACAAAGAAAGAAAAAGAGGG 0: 1
1: 2
2: 17
3: 281
4: 2279

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028132508 Original CRISPR TGTAGCACGTAAAAACTGGC AGG (reversed) Intronic
904916432 1:33973688-33973710 TTTAGCACGTAAGAGCTGGCTGG + Intronic
909494191 1:76260019-76260041 TGAAGCATGGAATAACTGGCTGG + Intronic
910241772 1:85094235-85094257 TTTAGCACTTGAAATCTGGCTGG - Intronic
912261845 1:108118594-108118616 TGAAGCACGTGATCACTGGCTGG - Intergenic
923213109 1:231824056-231824078 CTTAGCACCTAAAAAGTGGCTGG + Intronic
923658183 1:235936595-235936617 TGTAATACGTATAAACTGCCTGG - Intergenic
923964517 1:239122425-239122447 TGTAGGAAGTAAAAGCTGCCAGG + Intergenic
1074940394 10:118230967-118230989 GGTAGTCCATAAAAACTGGCTGG - Intergenic
1075190011 10:120298545-120298567 TGGAGCACTTAAAAGCTGGTAGG + Intergenic
1079208478 11:18439264-18439286 TATAGAACTTAAAAATTGGCTGG + Intronic
1080922667 11:36724384-36724406 TGTAGCACATAACAATTGGTTGG + Intergenic
1085563703 11:77493858-77493880 TGTAGAAAGTATAAACTGACTGG + Intergenic
1091878764 12:3959712-3959734 TTAAGCACCTAAAAAGTGGCAGG + Intergenic
1098066106 12:66618397-66618419 TGTACGAAGTAGAAACTGGCTGG + Intronic
1098130859 12:67348365-67348387 TGAAGCAAGTACAAACTGGGTGG + Intergenic
1099223905 12:79945739-79945761 TGTGGCATGTAAAAACTGGAAGG + Intergenic
1112759159 13:102673284-102673306 TGTAGCATGTGAAAACTGCCGGG - Intronic
1116356632 14:43938678-43938700 TGTAGCAGGTAAAGTATGGCTGG + Intergenic
1133808987 16:9146728-9146750 TGAAAAATGTAAAAACTGGCGGG + Intergenic
1134271710 16:12738876-12738898 TGTAGCAGCTAAACCCTGGCAGG + Intronic
1140591054 16:76353124-76353146 TGTAGCATGTAAAAAATTTCTGG + Intronic
1149286922 17:55175604-55175626 TGAAGCACCCAAAAACTAGCAGG + Intergenic
1155149902 18:23114867-23114889 TGCAGCAATTAATAACTGGCTGG - Intergenic
1155984918 18:32219663-32219685 CTTAGCAAGTAAAAACTGGAAGG + Intronic
1161778369 19:6276175-6276197 TTTAGGACAAAAAAACTGGCAGG + Intronic
926026759 2:9551890-9551912 TGTAGCATGTAAAATCAGTCAGG - Intronic
931063939 2:58563152-58563174 AGTAGGACATAAAAACTGACTGG + Intergenic
933431842 2:82191583-82191605 TATAGAAGATAAAAACTGGCCGG + Intergenic
935375419 2:102391009-102391031 AGTAGCAGATAAAAACTGGCAGG - Intronic
943527550 2:189036678-189036700 TGTACCACGTAAAACCTGGTGGG - Exonic
1170002515 20:11630830-11630852 TTTAGCACATAAAAACTTTCTGG - Intergenic
1172112664 20:32556475-32556497 TGTAGCCCTTAATAGCTGGCAGG - Intronic
1178952237 21:36994532-36994554 TGCAGCTCTTAAAAACTGGGAGG + Intergenic
953366494 3:42350036-42350058 TGTATCAGGTAAAATCTGGCCGG - Intergenic
956923755 3:73959704-73959726 TGGAGCAGGTCAAAACTCGCAGG - Intergenic
958501809 3:94920537-94920559 TGTAGCACTTAAAATGTGCCAGG + Intergenic
961618268 3:128201207-128201229 TGTGTCACCTAAAATCTGGCAGG + Intronic
971116380 4:23650766-23650788 GGTAGCTGGCAAAAACTGGCTGG - Intergenic
976173434 4:82328134-82328156 TGTATCACTTAACAACTGGGAGG + Intergenic
988704590 5:33712217-33712239 TCTAACAAATAAAAACTGGCTGG + Intronic
994738241 5:103585136-103585158 TCTAGCACGTGACAACTGGTAGG - Intergenic
1004422343 6:15482194-15482216 TGTGTCACATAAAAACTGACAGG - Intronic
1023352498 7:39334543-39334565 TGTAGAAGGTGAAAACTTGCTGG - Intronic
1023584272 7:41712837-41712859 TGTAACAGGTAAAAACTTTCAGG - Intergenic
1024837217 7:53535890-53535912 TGTAGCACAGAAAAATTGGGTGG - Intergenic
1024973459 7:55091698-55091720 AGTAGCACTTAAACAATGGCAGG + Intronic
1028132508 7:87192868-87192890 TGTAGCACGTAAAAACTGGCAGG - Intronic
1032727926 7:134609475-134609497 TAAAAAACGTAAAAACTGGCCGG + Intergenic
1036410885 8:8499284-8499306 TGTAGCATTTACAAACAGGCAGG + Intergenic
1039991797 8:42494591-42494613 TATATCAAGTAAAAACTAGCAGG - Intronic
1043710150 8:83405487-83405509 TGTAGCATGTAAAAAATAGGAGG - Intergenic
1048808964 8:138267910-138267932 TGTAGCAAGTAAAAACAGAGAGG - Intronic
1060403773 9:123362841-123362863 TGTAGAAAGAAGAAACTGGCTGG - Intronic
1188331512 X:28877417-28877439 TGAAACACATAAAGACTGGCAGG - Intronic
1192499499 X:71640409-71640431 TTTAAAATGTAAAAACTGGCCGG + Intergenic
1198209306 X:134501844-134501866 TTTTGCAGGTAAAAAATGGCCGG + Intronic