ID: 1028140769

View in Genome Browser
Species Human (GRCh38)
Location 7:87272770-87272792
Sequence CAAAACCAAAGACACAAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028140769_1028140770 -5 Left 1028140769 7:87272770-87272792 CCTTTTTTGTGTCTTTGGTTTTG No data
Right 1028140770 7:87272788-87272810 TTTTGATATCAGAGTAATGCTGG 0: 8
1: 108
2: 683
3: 2473
4: 8174
1028140769_1028140771 14 Left 1028140769 7:87272770-87272792 CCTTTTTTGTGTCTTTGGTTTTG No data
Right 1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028140769 Original CRISPR CAAAACCAAAGACACAAAAA AGG (reversed) Intergenic
No off target data available for this crispr