ID: 1028140771

View in Genome Browser
Species Human (GRCh38)
Location 7:87272807-87272829
Sequence CTGGCCTTGTAGAAGAGTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028140769_1028140771 14 Left 1028140769 7:87272770-87272792 CCTTTTTTGTGTCTTTGGTTTTG No data
Right 1028140771 7:87272807-87272829 CTGGCCTTGTAGAAGAGTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028140771 Original CRISPR CTGGCCTTGTAGAAGAGTAA AGG Intergenic
No off target data available for this crispr