ID: 1028141732

View in Genome Browser
Species Human (GRCh38)
Location 7:87281955-87281977
Sequence AGTTATCTTCAGAAGATGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028141732_1028141736 15 Left 1028141732 7:87281955-87281977 CCTGCCATCTTCTGAAGATAACT No data
Right 1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG No data
1028141732_1028141737 16 Left 1028141732 7:87281955-87281977 CCTGCCATCTTCTGAAGATAACT No data
Right 1028141737 7:87281994-87282016 ACAGCTCTTGGCCTGTTATTGGG No data
1028141732_1028141738 22 Left 1028141732 7:87281955-87281977 CCTGCCATCTTCTGAAGATAACT No data
Right 1028141738 7:87282000-87282022 CTTGGCCTGTTATTGGGATTTGG No data
1028141732_1028141734 4 Left 1028141732 7:87281955-87281977 CCTGCCATCTTCTGAAGATAACT No data
Right 1028141734 7:87281982-87282004 TCCTTTTGAGAGACAGCTCTTGG 0: 181
1: 197
2: 163
3: 130
4: 293
1028141732_1028141739 25 Left 1028141732 7:87281955-87281977 CCTGCCATCTTCTGAAGATAACT No data
Right 1028141739 7:87282003-87282025 GGCCTGTTATTGGGATTTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028141732 Original CRISPR AGTTATCTTCAGAAGATGGC AGG (reversed) Intergenic
No off target data available for this crispr