ID: 1028141736

View in Genome Browser
Species Human (GRCh38)
Location 7:87281993-87282015
Sequence GACAGCTCTTGGCCTGTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028141733_1028141736 11 Left 1028141733 7:87281959-87281981 CCATCTTCTGAAGATAACTACTC No data
Right 1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG No data
1028141731_1028141736 16 Left 1028141731 7:87281954-87281976 CCCTGCCATCTTCTGAAGATAAC No data
Right 1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG No data
1028141732_1028141736 15 Left 1028141732 7:87281955-87281977 CCTGCCATCTTCTGAAGATAACT No data
Right 1028141736 7:87281993-87282015 GACAGCTCTTGGCCTGTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028141736 Original CRISPR GACAGCTCTTGGCCTGTTAT TGG Intergenic
No off target data available for this crispr