ID: 1028142985

View in Genome Browser
Species Human (GRCh38)
Location 7:87291930-87291952
Sequence TGTCCCAGGAAGCACCTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028142979_1028142985 20 Left 1028142979 7:87291887-87291909 CCTCACTTCTATGGGAATTCAGC No data
Right 1028142985 7:87291930-87291952 TGTCCCAGGAAGCACCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028142985 Original CRISPR TGTCCCAGGAAGCACCTAGA TGG Intergenic
No off target data available for this crispr