ID: 1028143013

View in Genome Browser
Species Human (GRCh38)
Location 7:87292076-87292098
Sequence CTGGACACCCTGTGATCACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028143002_1028143013 23 Left 1028143002 7:87292030-87292052 CCTACTTCTGCCTGAAATTGCAG No data
Right 1028143013 7:87292076-87292098 CTGGACACCCTGTGATCACAGGG No data
1028143004_1028143013 13 Left 1028143004 7:87292040-87292062 CCTGAAATTGCAGAGAGGCACAG No data
Right 1028143013 7:87292076-87292098 CTGGACACCCTGTGATCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028143013 Original CRISPR CTGGACACCCTGTGATCACA GGG Intergenic
No off target data available for this crispr