ID: 1028144192

View in Genome Browser
Species Human (GRCh38)
Location 7:87304038-87304060
Sequence TAGAAAGCTACCCTCAGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028144190_1028144192 11 Left 1028144190 7:87304004-87304026 CCTTTTATAAACAGAAAGGCATA No data
Right 1028144192 7:87304038-87304060 TAGAAAGCTACCCTCAGTCTTGG No data
1028144188_1028144192 19 Left 1028144188 7:87303996-87304018 CCTTATTTCCTTTTATAAACAGA No data
Right 1028144192 7:87304038-87304060 TAGAAAGCTACCCTCAGTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028144192 Original CRISPR TAGAAAGCTACCCTCAGTCT TGG Intergenic
No off target data available for this crispr