ID: 1028146382

View in Genome Browser
Species Human (GRCh38)
Location 7:87324263-87324285
Sequence CCCAGGAACACCATGTTCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028146382_1028146387 16 Left 1028146382 7:87324263-87324285 CCTAAGAACATGGTGTTCCTGGG No data
Right 1028146387 7:87324302-87324324 TTCTTTACTCACCACAGGTTAGG 0: 19
1: 54
2: 196
3: 204
4: 264
1028146382_1028146391 30 Left 1028146382 7:87324263-87324285 CCTAAGAACATGGTGTTCCTGGG No data
Right 1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG No data
1028146382_1028146386 11 Left 1028146382 7:87324263-87324285 CCTAAGAACATGGTGTTCCTGGG No data
Right 1028146386 7:87324297-87324319 TGATATTCTTTACTCACCACAGG No data
1028146382_1028146389 28 Left 1028146382 7:87324263-87324285 CCTAAGAACATGGTGTTCCTGGG No data
Right 1028146389 7:87324314-87324336 CACAGGTTAGGAACCCTGTTCGG No data
1028146382_1028146390 29 Left 1028146382 7:87324263-87324285 CCTAAGAACATGGTGTTCCTGGG No data
Right 1028146390 7:87324315-87324337 ACAGGTTAGGAACCCTGTTCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028146382 Original CRISPR CCCAGGAACACCATGTTCTT AGG (reversed) Intergenic
No off target data available for this crispr