ID: 1028146385

View in Genome Browser
Species Human (GRCh38)
Location 7:87324286-87324308
Sequence TAAAGAATATCACTTTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028146385_1028146387 -7 Left 1028146385 7:87324286-87324308 CCTGTAGAAAGTGATATTCTTTA No data
Right 1028146387 7:87324302-87324324 TTCTTTACTCACCACAGGTTAGG 0: 19
1: 54
2: 196
3: 204
4: 264
1028146385_1028146389 5 Left 1028146385 7:87324286-87324308 CCTGTAGAAAGTGATATTCTTTA No data
Right 1028146389 7:87324314-87324336 CACAGGTTAGGAACCCTGTTCGG No data
1028146385_1028146395 29 Left 1028146385 7:87324286-87324308 CCTGTAGAAAGTGATATTCTTTA No data
Right 1028146395 7:87324338-87324360 GGCTGTGTAGACAAAGTATGAGG No data
1028146385_1028146390 6 Left 1028146385 7:87324286-87324308 CCTGTAGAAAGTGATATTCTTTA No data
Right 1028146390 7:87324315-87324337 ACAGGTTAGGAACCCTGTTCGGG No data
1028146385_1028146392 8 Left 1028146385 7:87324286-87324308 CCTGTAGAAAGTGATATTCTTTA No data
Right 1028146392 7:87324317-87324339 AGGTTAGGAACCCTGTTCGGGGG No data
1028146385_1028146391 7 Left 1028146385 7:87324286-87324308 CCTGTAGAAAGTGATATTCTTTA No data
Right 1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028146385 Original CRISPR TAAAGAATATCACTTTCTAC AGG (reversed) Intergenic
No off target data available for this crispr