ID: 1028146391

View in Genome Browser
Species Human (GRCh38)
Location 7:87324316-87324338
Sequence CAGGTTAGGAACCCTGTTCG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028146385_1028146391 7 Left 1028146385 7:87324286-87324308 CCTGTAGAAAGTGATATTCTTTA No data
Right 1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG No data
1028146384_1028146391 13 Left 1028146384 7:87324280-87324302 CCTGGGCCTGTAGAAAGTGATAT No data
Right 1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG No data
1028146382_1028146391 30 Left 1028146382 7:87324263-87324285 CCTAAGAACATGGTGTTCCTGGG No data
Right 1028146391 7:87324316-87324338 CAGGTTAGGAACCCTGTTCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028146391 Original CRISPR CAGGTTAGGAACCCTGTTCG GGG Intergenic
No off target data available for this crispr