ID: 1028149111

View in Genome Browser
Species Human (GRCh38)
Location 7:87351661-87351683
Sequence TCACCACGTTGAATGCCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028149107_1028149111 22 Left 1028149107 7:87351616-87351638 CCACAGGATTCTTTATTGGCTCA 0: 1
1: 0
2: 0
3: 14
4: 194
Right 1028149111 7:87351661-87351683 TCACCACGTTGAATGCCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028149111 Original CRISPR TCACCACGTTGAATGCCTGT GGG Intronic