ID: 1028149111 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 7:87351661-87351683 |
Sequence | TCACCACGTTGAATGCCTGT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1028149107_1028149111 | 22 | Left | 1028149107 | 7:87351616-87351638 | CCACAGGATTCTTTATTGGCTCA | 0: 1 1: 0 2: 0 3: 14 4: 194 |
||
Right | 1028149111 | 7:87351661-87351683 | TCACCACGTTGAATGCCTGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1028149111 | Original CRISPR | TCACCACGTTGAATGCCTGT GGG | Intronic | ||