ID: 1028149138

View in Genome Browser
Species Human (GRCh38)
Location 7:87351935-87351957
Sequence AAGGGTTAAGTCTCTATTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 84}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028149138_1028149142 12 Left 1028149138 7:87351935-87351957 CCTGCAATAGAGACTTAACCCTT 0: 1
1: 0
2: 0
3: 5
4: 84
Right 1028149142 7:87351970-87351992 CTTAGATTCTATTTATAATTTGG 0: 1
1: 4
2: 14
3: 110
4: 565

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028149138 Original CRISPR AAGGGTTAAGTCTCTATTGC AGG (reversed) Intronic
903766689 1:25739792-25739814 CAGGGTTAAGTGTCTACTCCAGG - Intronic
904189963 1:28736310-28736332 AAGGGGTGAATCTCTTTTGCGGG + Intergenic
904883132 1:33715505-33715527 AAGGGTTGAGTCTCACTGGCTGG + Intronic
905111021 1:35594714-35594736 AAGAGCTAAGTCCCTATTTCAGG - Exonic
907834582 1:58097037-58097059 AAGGGTTAAGGGTAAATTGCTGG - Intronic
910707157 1:90141969-90141991 AAGAGTCAAGTCTTTTTTGCAGG - Intergenic
910958710 1:92737389-92737411 AAGGGTTAAGTTTCTGTTTTAGG + Intronic
915296591 1:154925700-154925722 AAAGGTTAAGTCTCTTTCCCAGG - Intronic
915492789 1:156260673-156260695 AAGGGTTATGTCTCTCTGACTGG - Intronic
920691683 1:208151739-208151761 ACATGTTAAGTGTCTATTGCAGG + Intronic
1063681748 10:8194877-8194899 AAGGGTTATGTCTCCATAGGAGG - Intergenic
1069429038 10:68317044-68317066 ATGAGTTATGTCTCTCTTGCTGG - Intronic
1076050541 10:127329635-127329657 AAGTGAGAAGTCTCTACTGCTGG - Intronic
1076232848 10:128836112-128836134 ATGGTTTTAGTCTCTATTGATGG - Intergenic
1079311469 11:19370280-19370302 AATGGTTAAGTCTTTCTTGCTGG + Intronic
1079995223 11:27288559-27288581 AAGGGTTATGTCTTTACTACAGG - Intergenic
1086554953 11:88098361-88098383 AAAACTTAAGTCTATATTGCAGG + Intergenic
1088116070 11:106316377-106316399 AAGGCTTAAATTTCTATTTCAGG - Intergenic
1088886486 11:114011551-114011573 AAGGGTTAAGAGGCTGTTGCAGG - Intergenic
1089026717 11:115278529-115278551 TAGGATAAAGTCTCTATTTCTGG - Intronic
1090672420 11:128958014-128958036 AAGGGGGGCGTCTCTATTGCAGG + Intergenic
1090975348 11:131675391-131675413 AAAGGTTCAGTCTGTATTACTGG - Intronic
1095231168 12:39741912-39741934 AAGGGTTAAGTCACATCTGCAGG - Intronic
1100672557 12:96832776-96832798 AAGAATTAGGTCTATATTGCAGG + Intronic
1101336709 12:103803030-103803052 AAGGGGTAAGTGTCTATGGAGGG + Intronic
1103609910 12:122116957-122116979 CAGGGTGAAGTCACCATTGCAGG + Intronic
1109986709 13:69995706-69995728 AAAGGTTTAGTCTCTGCTGCTGG - Intronic
1111834750 13:93374439-93374461 CAGGGTAAAGACTCTGTTGCAGG - Intronic
1112989119 13:105489309-105489331 TGGGGTTAAGTATCTTTTGCAGG - Intronic
1122331148 14:100914903-100914925 AAGGGGAAAGCCTGTATTGCAGG - Intergenic
1128932160 15:71714987-71715009 AAGGGTTATGTATCTAATGATGG - Intronic
1131279441 15:91008914-91008936 ATGGGTAAAGTCTCTCTGGCTGG + Intronic
1133149779 16:3818947-3818969 AAGGGTGAAGCCTCTAGTGGGGG - Intronic
1134068799 16:11247850-11247872 AAGGGTTACCTCTTTGTTGCGGG + Intergenic
1139603733 16:68002939-68002961 TAGGGTGAAGTCAATATTGCAGG + Intronic
1146986013 17:37218938-37218960 AAGGATTTAGTCTCTCTTCCAGG - Intronic
1152263065 17:79277680-79277702 AAGGGTCAAGTCACTGTTGCGGG + Intronic
1156824458 18:41413978-41414000 GAGGGTTAAGTGTCAAGTGCTGG - Intergenic
1156974011 18:43194375-43194397 AAGGGTTAAGTCACGCCTGCTGG - Intergenic
1157469865 18:47980772-47980794 AAGGCTGAAGTCACTCTTGCTGG - Intergenic
1164493405 19:28735626-28735648 AAGGGTTAGGTCTCCAGCGCAGG + Intergenic
1164891052 19:31823930-31823952 AAAGGTTTAGAGTCTATTGCTGG - Intergenic
1167723365 19:51194213-51194235 AAGGGTGAAGTCTGTTTTTCGGG - Intergenic
925123731 2:1438971-1438993 AAAGGTTCAGGCTCTACTGCAGG - Intronic
925589956 2:5499772-5499794 AATGGTTAAGTCTCGACTACAGG + Intergenic
925811128 2:7701940-7701962 AAGGATTAAGTCACGCTTGCAGG + Intergenic
927993317 2:27463790-27463812 TAGTGTTAAGGCTCTATAGCAGG + Intronic
939266812 2:139884932-139884954 ATGGGTTAAGACTCTCTTGGGGG - Intergenic
941441618 2:165544889-165544911 GAGGGTTAAGTCTCAATTCTTGG - Intronic
942625372 2:177894711-177894733 AAGGGTTAAGTCATTCCTGCAGG + Intronic
946087885 2:217192689-217192711 GAGGGTTCACTCTCTACTGCAGG - Intergenic
1173370748 20:42432636-42432658 AAGGGTTAAGTCACAGCTGCAGG + Intronic
950036402 3:9889031-9889053 AAGAGTTAAGTCTTTATCCCAGG - Intergenic
957360376 3:79148986-79149008 AAGTGTTAAGTCCCAATTGCTGG - Intronic
959121337 3:102236169-102236191 AAGGTGTGAGTCTCTATTGCAGG + Intronic
960280439 3:115775325-115775347 ACAGATTCAGTCTCTATTGCGGG - Intergenic
962017218 3:131454151-131454173 AAGGGTTGAGTATGTATTGGGGG - Intergenic
966578527 3:181531880-181531902 CAGGGTTAACTCTCTTTTTCTGG + Intergenic
967345522 3:188451290-188451312 AAGTGTTAAGTGTCTGTTTCTGG + Intronic
968165678 3:196463103-196463125 GAGAGTTAAGTCTGTATTGTGGG - Intergenic
975618102 4:76267520-76267542 AAGATTTAAGTCTTTATTGGAGG + Intronic
978260600 4:106752833-106752855 AAGGGTGAATTCACTATTGAGGG + Intergenic
981546408 4:145898679-145898701 AAGTGTCACGTCTCTCTTGCAGG + Intronic
984506447 4:180624978-180625000 AAGGATTAAGATTCTTTTGCGGG + Intergenic
993714412 5:91261072-91261094 AAGGGTTAAGTTTCTACTAATGG + Intergenic
994045085 5:95299126-95299148 AAGGTTTAAAACTCTATTGTGGG + Intergenic
996318533 5:122188448-122188470 AAGGTTTAATACTCTGTTGCAGG + Intergenic
996779144 5:127165607-127165629 TAGCATTAAGTGTCTATTGCAGG + Intergenic
996930923 5:128885849-128885871 ACTGGTTAAGAATCTATTGCAGG + Intronic
997351997 5:133237419-133237441 AAGAGTTAAGTCTCTGCTCCTGG - Intronic
997408972 5:133675673-133675695 AAGGGTTAAATCTCAAGTCCTGG - Intergenic
998748366 5:145288245-145288267 AATAGTTAAATCTCTATTGGGGG - Intergenic
1003170187 6:3715309-3715331 TACAGTTAAGTCTCTATTGATGG - Intergenic
1005343537 6:24866470-24866492 TGGGGATAATTCTCTATTGCAGG - Intronic
1005562394 6:27054093-27054115 AAGGGTGAAGGCTCCATTCCAGG - Intergenic
1010169017 6:72952929-72952951 AAGAGTTCAATCTCTATTTCCGG - Intronic
1012073260 6:94650590-94650612 AAGGCTTAAATCTCTCTTTCTGG + Intergenic
1012603161 6:101123032-101123054 AGGGGTTAAGTCACTTTTGCAGG + Intergenic
1026948820 7:74333789-74333811 GAGGTTTAAGTCTGTGTTGCTGG + Intronic
1028026860 7:85853834-85853856 ACCAGTTAAGACTCTATTGCAGG - Intergenic
1028149138 7:87351935-87351957 AAGGGTTAAGTCTCTATTGCAGG - Intronic
1044881010 8:96722313-96722335 AAGGTTTAAATATCTATAGCAGG + Intronic
1045680555 8:104655133-104655155 AAAGGTTAAGTCACACTTGCAGG + Intronic
1046216857 8:111160035-111160057 AAGTCTTAAATCTCTAGTGCAGG - Intergenic
1053179352 9:35954949-35954971 AAGTGTTAATTCTCTATCACTGG + Intergenic
1055391313 9:75825109-75825131 ATAGGTTAAGACTATATTGCTGG + Intergenic
1056966429 9:91166350-91166372 CAGGGTGGAGTCTCTGTTGCTGG - Intergenic
1057005175 9:91550888-91550910 AAGAGTTAAGTGTCTCTTTCAGG + Intergenic
1188274486 X:28182880-28182902 AAGGGTTAAGTCTGCATGTCTGG + Intergenic
1197412643 X:126138432-126138454 AAGGGTTAGATCTCTGTTTCTGG + Intergenic