ID: 1028150658

View in Genome Browser
Species Human (GRCh38)
Location 7:87367672-87367694
Sequence TTGACTAAGCAAGAGGAAGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 199}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028150658 Original CRISPR TTGACTAAGCAAGAGGAAGC GGG (reversed) Intronic
901090560 1:6638018-6638040 TTTACTGAGCAGGAGGGAGCAGG - Intronic
901322260 1:8346983-8347005 TTGACAAGCCAAGAGTAAGCGGG - Intergenic
901329397 1:8393446-8393468 TTGAGTCAGCAAGAGAAAGGAGG - Intronic
902957580 1:19936290-19936312 TTGAATGAGAAAGAGGAAGCAGG - Intergenic
905205642 1:36341444-36341466 TGGACTGAGCAAGAGGGAGGAGG - Exonic
905343745 1:37297292-37297314 TTTATGGAGCAAGAGGAAGCAGG - Intergenic
905542039 1:38767593-38767615 TTGACTACAGAAGAGGAAGTCGG - Intergenic
905609170 1:39334080-39334102 TTGACTAAGCAAGTGGTAGATGG + Intronic
906099979 1:43254018-43254040 TTGAATGAGCAAGAAGAAACTGG + Intronic
908741678 1:67335275-67335297 TTGATAAAGCAAGAGGGAGCGGG + Intronic
909273348 1:73652719-73652741 ATGAGCAAGCAAGAGCAAGCAGG - Intergenic
909842195 1:80341891-80341913 TTGACTAGGCAGGGGGAAGTGGG - Intergenic
909951763 1:81728286-81728308 TTGACTAAGCAAAATCCAGCAGG + Intronic
910093251 1:83490665-83490687 TGGACAAAGCAAGAGAAAGAAGG - Intergenic
910438449 1:87228787-87228809 TTGACTACAGAAGAGGAAGAAGG + Intergenic
910873956 1:91859981-91860003 TAGACTAAGCGAGAGTCAGCTGG - Intronic
910984720 1:92994338-92994360 TTGACTAAGGAAGAGCAATTTGG + Intergenic
911817404 1:102370421-102370443 TTGACTAGGCAAGAGAAAAATGG + Intergenic
912702023 1:111885162-111885184 GTGACTAAGGAGGAGGAAGGTGG + Intronic
912836906 1:113004766-113004788 ATTACAAAGCAAAAGGAAGCTGG + Intergenic
913376336 1:118156742-118156764 TTGAGAAAGGAAGAGGGAGCAGG - Intronic
918358843 1:183733991-183734013 TTTACTAAGCCAGAGGAAAATGG - Intronic
919396690 1:197058592-197058614 TTGACTGCAGAAGAGGAAGCAGG - Intronic
920511329 1:206554544-206554566 TGGACTTAGGAAGAGGAGGCTGG - Intronic
1063172208 10:3518934-3518956 TTGACCTAGCAAGAGGCAGCAGG + Intergenic
1063245746 10:4216450-4216472 TTGACTTAGGAAGGGGAAGAAGG + Intergenic
1068878286 10:62021463-62021485 TTGAATATGAAAGAGGAAGTTGG + Intronic
1069149519 10:64940366-64940388 TTGAATAAGGAAGACAAAGCAGG - Intergenic
1069504352 10:68984260-68984282 TGGATTAAGCAAGAGAAATCAGG - Exonic
1071950076 10:90693172-90693194 TTGACAAAGAAAAAGGAAGATGG + Intergenic
1073881723 10:107989332-107989354 TTGAATAAGAAAAAGAAAGCTGG + Intergenic
1074026700 10:109643144-109643166 GTGGCCAAGCAAGAGGCAGCTGG + Intergenic
1074263033 10:111873005-111873027 TTCACAAATCAAGAGGAAGGTGG + Intergenic
1074805108 10:117042052-117042074 TACATTAAGGAAGAGGAAGCAGG + Intronic
1079115068 11:17635378-17635400 ATTACTAAGCACGAGGAAACTGG + Intronic
1085821849 11:79802272-79802294 TTGACTTAGCAATAGAGAGCTGG + Intergenic
1085885501 11:80517329-80517351 TTGTCTGAGCAGGAGGAAGAGGG - Intergenic
1086165219 11:83769916-83769938 CAGACTTAGGAAGAGGAAGCAGG - Intronic
1086366732 11:86114521-86114543 TTTACTAATCAAAAGAAAGCTGG - Intergenic
1089501062 11:118931364-118931386 TTGACTAAGGAAGGGTGAGCTGG + Intronic
1089649374 11:119902392-119902414 TTGGCTAAGCAAGAAGAATGGGG + Intergenic
1089872543 11:121688775-121688797 TTCACAAAGCAAAAGGAAACAGG - Intergenic
1091362010 11:134985430-134985452 TTTACTAAGCTCGAGGAACCTGG + Intergenic
1092571059 12:9721719-9721741 ATGAACAAGAAAGAGGAAGCAGG - Intronic
1094054979 12:26259720-26259742 TAGACTAATAAAGAGGAAGAAGG + Intronic
1095316823 12:40772797-40772819 TTGTCTAAGCAATAGAAAGAAGG + Intronic
1096609368 12:52790877-52790899 TTGAGAAAGCAAGAGAAAGTGGG + Intronic
1097685131 12:62684089-62684111 TTCACTAAGCAAGAGGATGGGGG + Intronic
1097835300 12:64266753-64266775 TTGCTTAAGCAATAGGATGCCGG - Exonic
1098068916 12:66650771-66650793 TTGAATAAACAAGAGGCAGTAGG - Intronic
1102302907 12:111783825-111783847 TTGGCTAAGCAAGAAGGATCTGG + Intronic
1102413790 12:112743029-112743051 TTGACTACAGAAGAGGAAGTAGG - Intronic
1104325648 12:127794100-127794122 TTCACTTAGCAACAGGAATCTGG - Intergenic
1106844859 13:33727650-33727672 TTGACCAAGAAAGAGGAGGTTGG - Intergenic
1108267250 13:48724426-48724448 TTGGCAAAGAAAGAGGCAGCAGG - Intergenic
1110480276 13:75965881-75965903 TTGATTATGGAAGAGCAAGCAGG + Intergenic
1111267685 13:85839560-85839582 TTGGCTAAGCAAGATAGAGCAGG + Intergenic
1112061500 13:95743853-95743875 TTAAATAAGCAGGAGGCAGCCGG - Intronic
1115795763 14:36933677-36933699 TAAACTGAGCAAGAGGAATCAGG + Intronic
1117818075 14:59619044-59619066 TTGACAAAGAAAGAGGATGTGGG + Intronic
1118977344 14:70689036-70689058 AAGACTAAGGAAGAGGAACCTGG + Intergenic
1120130179 14:80797407-80797429 TTCACTACTCAAGAGAAAGCAGG + Intronic
1121020321 14:90575991-90576013 TTGACCCAGCACGAGGGAGCTGG - Intronic
1122577272 14:102750306-102750328 TTGAATTAGCAAGAAGCAGCAGG + Intergenic
1125247609 15:37659932-37659954 TGAACAAAGAAAGAGGAAGCGGG + Intergenic
1127080716 15:55376118-55376140 TTGACGAAGAAACAGGAAACAGG - Intronic
1127918437 15:63474321-63474343 TTGACTAAGCAGATGAAAGCAGG - Intergenic
1128642849 15:69352555-69352577 TTGACAAAGGAAGAGAAAACCGG + Intronic
1128818648 15:70632195-70632217 CTGACAAAGGAAAAGGAAGCTGG - Intergenic
1128948798 15:71852661-71852683 TTGACTAAGAAACATGAAGCCGG - Intronic
1129074298 15:72978457-72978479 TTGAATAAGCTGGAGGAAGCAGG - Intergenic
1130245711 15:82246502-82246524 TTGACTAAGAAGGGGGAAGAGGG + Intronic
1136027481 16:27478576-27478598 CTCACTAAGCAAGCGGATGCTGG + Intronic
1136500511 16:30667718-30667740 GTCACTAAGCAAGTGGAACCAGG - Intronic
1137382108 16:48009133-48009155 CTGACAAAGAAAAAGGAAGCAGG + Intergenic
1138719080 16:59058309-59058331 TTGACAAAGGAAGAGAAAACAGG + Intergenic
1139009994 16:62619970-62619992 TCAACTAAGCAAGTGGAAGCTGG + Intergenic
1139045779 16:63057767-63057789 TCCACTAACCAAGATGAAGCTGG - Intergenic
1140379890 16:74477128-74477150 TTTAATAAGCAACAGGAAGAGGG + Intronic
1143300354 17:5905215-5905237 TTGATTAACCTAAAGGAAGCTGG + Intronic
1150454385 17:65294999-65295021 TTAAAGAAGCAAGAGGAGGCTGG + Intergenic
1150726821 17:67658062-67658084 CTGACTGAGCAAGAGGAACCTGG - Intronic
1151908655 17:77066621-77066643 CTGACTTAGAAAGAGGAAGAAGG - Intergenic
1152323776 17:79623941-79623963 TTGAAGAAGGAAGAGGGAGCTGG + Intergenic
1152984583 18:310239-310261 CTGACTAAGCAAGAGAAAAATGG + Intergenic
1153244785 18:3063181-3063203 CTGTCTAGGCAAGAAGAAGCTGG + Intergenic
1153749883 18:8218473-8218495 TTGAATAAGCAAGATGAATGGGG + Intronic
1155769870 18:29682966-29682988 TTGACAGAGAAAAAGGAAGCTGG + Intergenic
1157175124 18:45444650-45444672 TTGATTAAGCAGGATGAAACTGG + Intronic
1157434922 18:47660223-47660245 TTGTATAAACAAGAGGAAACAGG + Intergenic
1158456070 18:57608892-57608914 TAGAAAAAGCAAGAGGAAGAAGG + Intronic
1161063458 19:2226619-2226641 TTTCCTGAGCAAGAGGCAGCTGG + Exonic
1161149641 19:2701308-2701330 TTGACTAATCAGGAGGAAAACGG - Intronic
1161701477 19:5798243-5798265 TTGACTAACCTGGAGGAGGCAGG + Intergenic
1161797274 19:6394255-6394277 TTGGCTAAGCAAAGGGAAGGCGG + Intergenic
925513201 2:4650356-4650378 TTGAATAGGAAAGAGGAAGCAGG - Intergenic
926024161 2:9525416-9525438 TTCATGAAGCAAGAAGAAGCTGG - Intronic
927187761 2:20494313-20494335 TTCTGTAAGGAAGAGGAAGCAGG + Intergenic
927190929 2:20516449-20516471 TTGTCTAAGGAAGAGGGGGCTGG - Intergenic
927192176 2:20524361-20524383 TTGAATGGGGAAGAGGAAGCAGG + Intergenic
927929530 2:27035296-27035318 TTGTCTGAGCTTGAGGAAGCTGG - Intronic
930206153 2:48588132-48588154 TTGACTGAGCAAGTGGGATCTGG + Intronic
930242951 2:48955151-48955173 ATGACTAAGCACTAGGAAGCAGG - Intergenic
931641362 2:64383408-64383430 GGGAGAAAGCAAGAGGAAGCAGG - Intergenic
931669193 2:64631304-64631326 TTGGGAAAGCAAGAGGCAGCAGG + Intergenic
939605268 2:144246885-144246907 TGGACTTTGCAAGAGCAAGCTGG + Intronic
940279344 2:151973577-151973599 TTGCCTAAGAAATAAGAAGCGGG + Intronic
940543667 2:155055028-155055050 TTGACAAAGAAAAAGGAAGATGG + Intergenic
941310074 2:163916807-163916829 TTGAATAAGCAAGAGTAACAGGG + Intergenic
942486573 2:176446077-176446099 TGGGCTAGGCAAGAGGGAGCCGG - Intergenic
944186463 2:196954263-196954285 TTGACAAAGAAAGGGGAAGATGG + Intergenic
945043956 2:205765622-205765644 TGGGATAAGCAAGAGGAGGCAGG + Intronic
946900044 2:224363604-224363626 TTGACTACCGAAGAGGAAGAGGG - Intergenic
947722312 2:232377722-232377744 CTAACTCAGCAAGATGAAGCAGG + Intergenic
947735771 2:232454649-232454671 CTAACTCAGCAAGATGAAGCAGG + Intergenic
947867416 2:233408847-233408869 TTAAAGAAGCAGGAGGAAGCAGG + Intronic
1171233755 20:23508307-23508329 CTGACTGAGCTAGAGGATGCTGG - Intergenic
1171433931 20:25104645-25104667 GGGACTCAGCAAGAGGAACCGGG + Intergenic
1173758124 20:45535963-45535985 TTCACTTAGCAAGAGGGGGCTGG - Intronic
1177049412 21:16213433-16213455 TTGATTAAGCAAGAGGAAAAAGG + Intergenic
1182757455 22:32691308-32691330 AAGACTGAGCAAGAGGCAGCTGG + Intronic
1183664780 22:39241062-39241084 TTAGCAAAGCCAGAGGAAGCTGG + Intronic
1184076356 22:42181431-42181453 TTGAGTAAGAAAGTGGCAGCAGG - Intronic
949881652 3:8665829-8665851 TTGACCAGGAAAGAGGAACCAGG - Intronic
950725006 3:14911552-14911574 TTGACGAAGTATGAGGAAGCTGG - Intronic
950800132 3:15543910-15543932 CTGACTCATCAAGGGGAAGCTGG + Intergenic
952670676 3:35963676-35963698 TGGAATAAGCAGGAGGAAGAAGG + Intergenic
953708701 3:45251239-45251261 TTTAAAAAGCAAAAGGAAGCAGG + Intergenic
954073463 3:48159752-48159774 TGGAGAAAGCAAGGGGAAGCTGG - Intronic
957204033 3:77171349-77171371 TTTTCTAAGCAGGACGAAGCAGG - Intronic
959531832 3:107441860-107441882 ATGACAAAGCAAGAGGTAGCTGG + Intergenic
961257446 3:125568617-125568639 TTGGTTAGGAAAGAGGAAGCAGG - Intronic
961834907 3:129649602-129649624 TTGCCAAAGCAAAAGGAGGCTGG + Exonic
962007137 3:131360838-131360860 TTGATTATGCAATAGAAAGCAGG - Intergenic
962009501 3:131380554-131380576 TTGATTATGCAATAGAAAGCAGG - Intergenic
966225009 3:177588934-177588956 TTGACAAAGCAAGAAGAGACAGG - Intergenic
967669725 3:192218549-192218571 TTGACATAGGAAGGGGAAGCAGG - Intronic
967695488 3:192526431-192526453 TTGATTTAGCCAGAGGAATCAGG + Intronic
970015621 4:11509560-11509582 TTGACTAAGTAACAAGAAGAAGG + Intergenic
970229992 4:13899735-13899757 TTAACTCAGGAAAAGGAAGCTGG - Intergenic
970859915 4:20690272-20690294 ATGACGATGCAAGAGGAACCTGG - Intergenic
972370790 4:38421298-38421320 TTGACTAGGCAAGGATAAGCTGG - Intergenic
973898388 4:55440326-55440348 TTCAAAAAGCAAAAGGAAGCAGG - Intronic
975451315 4:74530315-74530337 TTGACTAATAAATAGGACGCAGG - Intergenic
975492057 4:75000052-75000074 TCAACAAAGCAAGAGGCAGCTGG - Intronic
978492981 4:109328675-109328697 TACAATAAGCAAGGGGAAGCAGG + Intergenic
979212449 4:118121585-118121607 TTAACTAAACCAGTGGAAGCGGG + Intronic
980773921 4:137414956-137414978 TTGATTAGGCAAGAGGATGACGG - Intergenic
981087394 4:140698274-140698296 AGGATTAAGGAAGAGGAAGCTGG - Intronic
982804924 4:159751548-159751570 TAGACTAAGAAAAAGGAAGAAGG - Intergenic
983832946 4:172352949-172352971 CTGTCTAAGCAAAAGTAAGCTGG - Intronic
986212740 5:5689573-5689595 TTGACAAAGAAAGGGGAAGATGG + Intergenic
986328732 5:6701990-6702012 TTGAAGAACCAAGAGGGAGCTGG + Intergenic
986599375 5:9456361-9456383 TTGACCAAGGAAGAGGAAGGAGG + Intronic
986787068 5:11124179-11124201 TAGCCTAAGCAAGAGAGAGCAGG - Intronic
989170809 5:38469112-38469134 ATGCCTCAGCAAGAGCAAGCGGG - Intergenic
990826338 5:59903274-59903296 TTGCCTAAGGATTAGGAAGCGGG + Intronic
990852262 5:60220035-60220057 TTGATTAGGAAAGAGGAAGCTGG + Intronic
991114615 5:62939707-62939729 TAGATAAAGAAAGAGGAAGCAGG + Intergenic
992860885 5:80908377-80908399 ATGACTAATCAAAAGGAAGCTGG + Intergenic
994301215 5:98150054-98150076 TTCAGTAAGTAAGAGGAAGGAGG - Intergenic
997984721 5:138492922-138492944 TTGACTCTGCAGGAGAAAGCTGG + Intergenic
1003358754 6:5402937-5402959 TGAAGTAAGCAAGAGCAAGCTGG - Intronic
1006495483 6:34420096-34420118 TTGAAAAAGCAAGTGGAAACAGG - Intronic
1007153311 6:39717300-39717322 TAGAGTAAGCAAGAGGTAGAGGG - Intronic
1007941044 6:45781981-45782003 TTGGCTAAGAAAGGGGAAGGGGG + Intergenic
1013774955 6:113669476-113669498 TGGCCTAATCCAGAGGAAGCAGG - Intergenic
1015563342 6:134540084-134540106 CTTACCGAGCAAGAGGAAGCGGG + Intergenic
1016878349 6:148885772-148885794 TGGACTAAGAAGGGGGAAGCAGG - Intronic
1017297357 6:152813614-152813636 TTGGATAAGCAAAAGGATGCTGG + Intergenic
1017495690 6:154981236-154981258 TTCATTAAGCAAGCTGAAGCTGG + Intronic
1019388149 7:770328-770350 CTGATTGAGAAAGAGGAAGCGGG + Intronic
1020634750 7:10683718-10683740 GGGATTAAGCAAGATGAAGCAGG - Intergenic
1020930038 7:14381600-14381622 TAGACAAAGCAAGAGGAAACTGG - Intronic
1021888882 7:25167701-25167723 TAGATAAAGCAGGAGGAAGCAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1026290867 7:69004811-69004833 TTGAATGAGCAAGAGGCACCAGG - Intergenic
1028150658 7:87367672-87367694 TTGACTAAGCAAGAGGAAGCGGG - Intronic
1030063004 7:105638034-105638056 TTTACACAGCAAGAGTAAGCTGG - Intronic
1030816625 7:114047408-114047430 TTGACTACACAAGAATAAGCTGG - Intronic
1031424170 7:121585597-121585619 TTGACAAAGAAAAAGGAAGATGG - Intergenic
1032555740 7:132832802-132832824 TTGACCAAGAAACAGGAGGCCGG + Intronic
1034426024 7:151014426-151014448 TCGACTAAGAAACAGGAAGCGGG - Exonic
1036079123 8:5534083-5534105 TTGACAAAGAAAGGGGAAGATGG + Intergenic
1036521455 8:9495159-9495181 TTGAAGAAGAAAGAGGGAGCAGG - Intergenic
1040518370 8:48153245-48153267 TGCAATTAGCAAGAGGAAGCAGG - Intergenic
1043689678 8:83134540-83134562 GGCACTAAGCAAGAAGAAGCAGG - Intergenic
1046899533 8:119509156-119509178 ATAGCTAAGCAAGAGGAGGCAGG + Intergenic
1047425565 8:124742430-124742452 GTGAGCAAGCAAGAGGAGGCTGG + Intergenic
1051483678 9:17585845-17585867 TTGAGGCAGCAAGAGGCAGCAGG + Intronic
1052859222 9:33426666-33426688 TTGACTAACAAAGGGGCAGCAGG + Intergenic
1052936059 9:34094078-34094100 AGGACTTTGCAAGAGGAAGCAGG - Intronic
1053784543 9:41644920-41644942 TACAGTCAGCAAGAGGAAGCCGG + Intergenic
1054172509 9:61855070-61855092 TACAGTCAGCAAGAGGAAGCCGG + Exonic
1054447361 9:65384081-65384103 TACAGTCAGCAAGAGGAAGCCGG + Intergenic
1054448128 9:65387942-65387964 TACAGTCAGCAAGAGGAAGCCGG + Intergenic
1054549918 9:66390503-66390525 TTGCCTAATCATGAGGAGGCGGG - Intergenic
1054665031 9:67725731-67725753 TACAGTCAGCAAGAGGAAGCCGG - Intergenic
1056372581 9:85972207-85972229 TTAAAAAAGGAAGAGGAAGCTGG + Intronic
1057167273 9:92938889-92938911 ATGAGTGAGCAAGAGGAAGAAGG - Intergenic
1058629715 9:106974144-106974166 TTTACTATGCACGTGGAAGCTGG + Exonic
1058838702 9:108884109-108884131 AAGACTAACCAAGAGAAAGCTGG + Intronic
1058865067 9:109154320-109154342 TTGTCTAAGCAAGAAGTTGCGGG - Intronic
1058975404 9:110121468-110121490 TTCGCTAAGCACCAGGAAGCAGG + Intronic
1059893150 9:118828187-118828209 TTGATTAAGAAAGAAAAAGCAGG - Intergenic
1060027624 9:120186309-120186331 TTAACTGAGGAAGAGGAGGCAGG + Intergenic
1060643630 9:125259986-125260008 TGAAATAAGCAAGAGGAGGCCGG - Intergenic
1060718300 9:125955275-125955297 CTGGCTGAGGAAGAGGAAGCGGG - Intronic
1062021852 9:134323321-134323343 CTGGCTGAGCATGAGGAAGCTGG - Intronic
1187368791 X:18686625-18686647 TTGGCTAAAAAACAGGAAGCGGG + Intronic
1188070587 X:25713628-25713650 TTGTCAATACAAGAGGAAGCTGG + Intergenic
1194960133 X:100225393-100225415 TTGACTTTACAAGAGTAAGCAGG - Intergenic
1195245966 X:102995604-102995626 TTGACTAAGCAGGATAAGGCAGG - Intergenic
1196276280 X:113768935-113768957 TTGACAAGACAAGAGGAAACAGG - Intergenic
1196764111 X:119227306-119227328 TTGACTAAGGCAGAGGAGGTAGG - Intergenic
1197195448 X:123695100-123695122 ATGACTAAGAAAGAGGGAGAAGG - Intronic
1198841691 X:140864670-140864692 TGGACGAAGAGAGAGGAAGCTGG + Intergenic
1198982004 X:142408710-142408732 TTGACCAAGCAAGAGGTAGCAGG - Intergenic
1199201508 X:145095217-145095239 CAGACTTAGGAAGAGGAAGCAGG - Intergenic
1200127906 X:153825498-153825520 TTGAGTTAGGAAAAGGAAGCAGG - Intronic