ID: 1028151723

View in Genome Browser
Species Human (GRCh38)
Location 7:87381331-87381353
Sequence GGGGCTGTTTCAGGTTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 211}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028151723 Original CRISPR GGGGCTGTTTCAGGTTTGCC AGG (reversed) Intronic
900581677 1:3412708-3412730 GGGGCTGCCCCAGGTGTGCCCGG + Exonic
901829758 1:11885239-11885261 GGGGCTGCATCAGCTTTGCTTGG - Intergenic
903269898 1:22181297-22181319 GGGGTTTTTTCATGTTGGCCTGG + Intergenic
903694417 1:25196523-25196545 GGGGCTTTGTCAGGTTGGCCAGG - Intergenic
903927239 1:26839277-26839299 AGGGCTGTTTCTGCTATGCCAGG - Intronic
904025606 1:27501509-27501531 GGGCCTGTTTGAGGTTTGGAGGG + Intergenic
904781907 1:32956172-32956194 GGGGTTTTGTCAGGTTGGCCAGG - Intronic
905569443 1:38991797-38991819 GGGTCGGTTTTAGGTTTTCCTGG + Intronic
906196229 1:43932233-43932255 GGGGCTGCTGCAGGCGTGCCAGG - Intergenic
906432471 1:45766176-45766198 GGGGTTTTATCATGTTTGCCAGG - Intergenic
907369517 1:53991906-53991928 GAAGCTGCTTGAGGTTTGCCGGG - Intergenic
908270333 1:62415772-62415794 GGGGTTTTATCATGTTTGCCAGG + Intergenic
912367219 1:109144241-109144263 GGGGCTTCTCCATGTTTGCCAGG + Intronic
916174614 1:162027313-162027335 GGGGCTGTTTCAAAAGTGCCAGG + Intergenic
916518465 1:165542051-165542073 GGGCTAGTTTCAGCTTTGCCAGG - Intergenic
918015747 1:180631337-180631359 GGGCCTGTTTCCGGTTTTACTGG + Intergenic
918195285 1:182215465-182215487 GGGGCTTTATCATGTTTGCCAGG + Intergenic
918262599 1:182809345-182809367 GGGGTTTTGTCAGGTTGGCCAGG - Intronic
920043281 1:203117567-203117589 GGGGCTGGGTTAGATTTGCCTGG + Intronic
923772858 1:236952453-236952475 GCAGCTGTTTCAGCTCTGCCTGG + Intergenic
1062963375 10:1590060-1590082 TGGGCTGTGTGAGGTTGGCCTGG + Intronic
1063258368 10:4354510-4354532 GGGACTGAGTCAGCTTTGCCGGG + Intergenic
1064234183 10:13558129-13558151 GGATTTGTTTCAGGTTTGCAAGG + Intergenic
1065323017 10:24526215-24526237 GTGGCTGTGGCAGTTTTGCCAGG - Intronic
1065752266 10:28897565-28897587 GGCGCTCTTTCATGTTTTCCTGG + Intergenic
1067984646 10:51129282-51129304 GGGGCTTTGTCATGTTGGCCAGG - Intronic
1069856042 10:71441525-71441547 GGGGTTGTGCCATGTTTGCCAGG - Intronic
1071572521 10:86705821-86705843 TGGGCTATTTCAGGTCTGCCTGG + Intronic
1072249886 10:93573043-93573065 GGGGTTGTTTCTGCTATGCCTGG - Intronic
1074509331 10:114098727-114098749 AGGGCTGTTTCAGCTTTCCCTGG - Intergenic
1076614419 10:131746564-131746586 GGGGCTGCAGCAGGGTTGCCCGG + Intergenic
1077082440 11:730078-730100 GGGGCTGGTTCAGCTTTGTGGGG - Intergenic
1078483902 11:11704493-11704515 GGGGCTCTCTCTGGGTTGCCTGG - Intergenic
1078539575 11:12202293-12202315 TGGACTGCTTCTGGTTTGCCAGG - Intronic
1083742176 11:64716812-64716834 GGGGCAGCTTCACGCTTGCCAGG + Intronic
1084954618 11:72684712-72684734 GGGGCTGCTGCAGGGCTGCCAGG + Intergenic
1085352077 11:75804614-75804636 GGGGCTTTGTCATGTTGGCCAGG - Intergenic
1089684475 11:120138047-120138069 TGAGCTGTTTCAGGCTTGCTGGG + Exonic
1090304163 11:125676097-125676119 GGGGTTTTTTCATGTTGGCCAGG + Intronic
1090943981 11:131413456-131413478 GGGGCTCTTTCAGGGTTGGAAGG - Intronic
1091371510 11:135063980-135064002 GATGCTGTTTCAGGTTTCTCTGG + Intergenic
1092197406 12:6557624-6557646 GTGGCTGTTTCAGAATTTCCTGG + Exonic
1097298130 12:57989284-57989306 AGGGCTATTTCAGGTAAGCCAGG + Intergenic
1102519218 12:113468533-113468555 GGGGCTGTCGCAGGTTTGGGAGG - Intronic
1103156569 12:118690048-118690070 TTGGCTGTTTCAGTTCTGCCTGG + Intergenic
1103307962 12:119981253-119981275 GGGGTTTTTTCATGTTGGCCAGG + Intergenic
1103619598 12:122178798-122178820 GGGGTTTTTTCATGTTGGCCAGG + Intronic
1104720103 12:131040605-131040627 GGGGCTGTTTCTGAGCTGCCCGG - Intronic
1105372206 13:19812027-19812049 GGGGTTTTATCATGTTTGCCAGG - Intergenic
1107272975 13:38642366-38642388 GGGGCTTTATCACGTTGGCCAGG - Intergenic
1109208373 13:59506488-59506510 AGGGCTGCTTCAGTTGTGCCAGG - Intergenic
1111562456 13:89968858-89968880 GGGGGTGTTTCTGGGTTGGCAGG - Intergenic
1114440062 14:22739045-22739067 GGGGTTTTTTCACGTTGGCCAGG - Intergenic
1115358952 14:32480004-32480026 GGGGCTGATTTAGGATTTCCTGG + Intronic
1116622488 14:47223901-47223923 GGGGCTTTTCCAGCTTTGCTTGG - Intronic
1117941049 14:60965482-60965504 GCAGCTGTTTCAGGTTTCTCAGG + Intronic
1119499181 14:75108744-75108766 GGGGTTTTGTCATGTTTGCCAGG + Intronic
1119567308 14:75639713-75639735 GAGTCTTTTTCAGTTTTGCCTGG + Intronic
1121243998 14:92449756-92449778 GGGGCTGTCTGAGGCTGGCCTGG - Intronic
1121470725 14:94152170-94152192 GGGGCTTTGTCATGTTGGCCAGG + Intronic
1121728975 14:96173248-96173270 GGGTCTGTTTCAGCGTAGCCAGG - Intergenic
1122260346 14:100515827-100515849 GGGGCTTCATCATGTTTGCCAGG + Intronic
1124000492 15:25755413-25755435 TGTGCTGTTTCAGCATTGCCTGG - Intronic
1126097739 15:45101170-45101192 GGGGCTCTGGCAGGTTGGCCTGG - Intronic
1126957575 15:53951403-53951425 TGGGCTGACCCAGGTTTGCCAGG + Intergenic
1128457634 15:67841206-67841228 AGGGCTCTTTCATGTCTGCCTGG - Intergenic
1129258042 15:74345306-74345328 GGGGCTGACTCAGTTTTCCCAGG + Intronic
1129756596 15:78102741-78102763 GGGGCTGGTTCAGGGTTCTCAGG + Intronic
1130613909 15:85386014-85386036 GGGGCTTTTCCATGTTGGCCAGG + Intronic
1130710885 15:86279823-86279845 GGGGCTCTCTGAGGTTTTCCTGG + Intronic
1131163660 15:90126842-90126864 GCGGCTATTTCAGGAATGCCGGG + Intergenic
1132002753 15:98196607-98196629 GGGGCTGTTTCTGCTTAGTCGGG + Intergenic
1132371147 15:101300076-101300098 GGGGTTTTGTCATGTTTGCCAGG + Intronic
1132753286 16:1468997-1469019 GGGGTTGCTTCATGTTGGCCAGG - Intronic
1132757920 16:1494902-1494924 GGGGACGTTCCAGGTTTTCCAGG + Intronic
1133550815 16:6853044-6853066 GAGGCTGTCTCTGGGTTGCCTGG - Intronic
1133931305 16:10234493-10234515 TGGGCTGCTTACGGTTTGCCTGG + Intergenic
1136385765 16:29925239-29925261 GAGGCTGCTTTGGGTTTGCCAGG - Intronic
1137307416 16:47216847-47216869 GGGGCTTTGTCATGTTGGCCAGG + Intronic
1137494675 16:48960662-48960684 GGGGCTGGTTGTGATTTGCCTGG + Intergenic
1138687821 16:58741043-58741065 GGGGCTTTGTCATGTTGGCCAGG + Intergenic
1138929989 16:61641655-61641677 GTGGGTGTTTCAGGTTTTCCTGG - Intergenic
1139649135 16:68353382-68353404 GGGTCTCTTTCAGGTGTGCAGGG + Intronic
1140022689 16:71253388-71253410 GGGGCTTTGTCATGTTGGCCAGG - Intergenic
1140410875 16:74739699-74739721 GGGGCTGTGACAGGCTTGGCAGG - Intronic
1140674181 16:77310817-77310839 GGGGTTTTTTCATGTTTCCCAGG + Intronic
1140779124 16:78277693-78277715 GGGGCCGTTTCATGTTTGCACGG + Intronic
1141225786 16:82113676-82113698 GGGGTTTTGTCATGTTTGCCAGG + Intergenic
1141284687 16:82660536-82660558 CGGGCTGTTTCTGTTTTGCCAGG - Intronic
1141402106 16:83757934-83757956 GGGGCTTTGTCATGTTGGCCAGG - Intronic
1141724122 16:85775122-85775144 GGGGCTGTCGCAGCTCTGCCGGG + Intronic
1142161578 16:88560480-88560502 TGGGCTGTTTCTGGTTTGGAGGG + Intergenic
1143399977 17:6637636-6637658 GGGGGTGTCTCAGGTTTGTTGGG - Intronic
1144125936 17:12202872-12202894 GGGCCTGTTTCCTGATTGCCAGG - Intergenic
1144507490 17:15845117-15845139 GGGGTTTTGTCACGTTTGCCAGG - Intergenic
1145171616 17:20662723-20662745 GGGGTTTTGTCATGTTTGCCAGG - Intergenic
1145249532 17:21289670-21289692 GAGGCTGTTTGAGGTTTCCAGGG - Intronic
1149830805 17:59870167-59870189 GGGGTTGTATCATGTTGGCCAGG - Intronic
1151124496 17:71830374-71830396 GGGGTTATTTCAGGTGAGCCAGG + Intergenic
1151778072 17:76222152-76222174 GGGGTTGCTTCATGTTGGCCAGG - Intronic
1156380779 18:36559163-36559185 GGGGCTTATTCAGGTTTTCAGGG + Intronic
1157097694 18:44701354-44701376 GGAGCTGCTTAAGGTTTCCCTGG - Exonic
1158463425 18:57667417-57667439 GGGGTTTTGTCATGTTTGCCAGG + Intronic
1158496291 18:57958080-57958102 GGGGCTTTTCCATGTTGGCCAGG + Intergenic
1161272392 19:3397314-3397336 GGGGCTGTTTGGGGTATGGCAGG + Intronic
1162370252 19:10274504-10274526 GGGGCTTTGTCATGTTGGCCAGG + Intronic
1164223414 19:23218462-23218484 GGGGTTGTGCCATGTTTGCCAGG + Intergenic
1165428416 19:35758022-35758044 GGAGGTGTTTCAGGATTGGCTGG - Exonic
1165487342 19:36103707-36103729 GGGTCAGTCTCAGGTTGGCCCGG - Exonic
1165812982 19:38623494-38623516 GGGGCTTTGTCATGTTGGCCAGG + Intronic
1165838791 19:38774611-38774633 GGGGCTGTTTCGGGCCTGGCGGG - Intergenic
1165895195 19:39137068-39137090 GTGGCTGCTTCAGGTGTTCCTGG + Intronic
1166269541 19:41705561-41705583 GGAGCTGTGTCAGGGATGCCTGG - Intronic
926070342 2:9883788-9883810 GGGGCTCTATCAGCTTTGCCAGG - Intronic
926757850 2:16250351-16250373 GGGGCTGTGTCAGGATTCCAGGG + Intergenic
927712360 2:25333697-25333719 GGGGTTGTTCCAGGGCTGCCTGG - Intronic
930688188 2:54331088-54331110 GGGGCTGTCTGAGCTTGGCCTGG - Intronic
933544917 2:83697675-83697697 GGGTCTGTTTGAGCTTTACCTGG - Intergenic
936499179 2:113052139-113052161 GGGGTTTCTTCATGTTTGCCAGG + Intronic
937439600 2:121904807-121904829 GGGGCTGGTTCAGCTTGGCAAGG + Intergenic
937902423 2:127031135-127031157 GGGGCATTTTCTGGTTTTCCTGG + Intergenic
938210132 2:129460093-129460115 GGTGCTGTCTCAGGCTGGCCTGG + Intergenic
941699972 2:168593881-168593903 AAGGCTGGTTCAAGTTTGCCTGG - Intronic
945061108 2:205909582-205909604 TGTGCTGTTTCAGGCTTGTCAGG - Intergenic
945851511 2:215013987-215014009 GGGGTTGTATCATGTTGGCCAGG - Intronic
947059298 2:226144636-226144658 GGAGCTGTTTCCAGTGTGCCAGG - Intergenic
948569245 2:238907110-238907132 GGGGCTGCTGCAGGCTGGCCTGG + Intronic
1169867241 20:10215350-10215372 GTTGCTGTTTCTGGTTTGCCAGG - Intergenic
1171937096 20:31285503-31285525 GGGACTGCTTCAGGTTTTGCTGG + Intergenic
1175133846 20:56808553-56808575 GGTGCTGTTTCCGGGTTTCCTGG + Intergenic
1175942395 20:62543526-62543548 GGGCCAGTCACAGGTTTGCCAGG - Intergenic
1175994523 20:62806064-62806086 GGGGCTGTTTCACTTTTTCCTGG + Intronic
1177381041 21:20344760-20344782 GGGCCTGTTTCAGGGTTGGAGGG - Intergenic
1181276945 22:21693470-21693492 GGGGCTGGCTCTGGTTTTCCAGG + Intronic
1181371725 22:22424414-22424436 GGGGCTTTTCCATGTTGGCCGGG - Intergenic
1181493955 22:23277551-23277573 GGGGCTGTTTCTGTCTTCCCTGG + Intronic
1182073760 22:27480803-27480825 TGGGCTGTCTCAGGTTCTCCGGG + Intergenic
1182572418 22:31249012-31249034 GAGGCTCCTTCAGGTTTGTCTGG - Intronic
1182703304 22:32258178-32258200 GGGGTTGTGTCATGTTGGCCAGG + Intergenic
1184353926 22:43965397-43965419 GGGGCTTTGTCATGTTGGCCAGG + Intronic
1185135181 22:49066401-49066423 GGGGTTTTGTCATGTTTGCCCGG - Intergenic
1185258431 22:49849085-49849107 TGGGGTGTTTCTGGTTCGCCCGG + Intergenic
949217144 3:1583561-1583583 TGGGCTGTTCCAGGTGTTCCAGG - Intergenic
949310687 3:2694536-2694558 GGGGCTTTGTTATGTTTGCCAGG - Intronic
949579292 3:5371042-5371064 GGGGTTTTTTCATGTTGGCCAGG + Intergenic
950053015 3:10006259-10006281 GGGGCTGCCGCAGGGTTGCCAGG + Intronic
950119589 3:10472752-10472774 GGGGTTGGTTCAGGTTCCCCGGG + Intronic
951694909 3:25436397-25436419 GGAACTGTTTCATGTTTGTCTGG + Intronic
952338173 3:32422800-32422822 GGGCATGTTTCAGGTGGGCCAGG - Intronic
953136747 3:40188447-40188469 AGGACTGTTGCAGGGTTGCCTGG - Intronic
953574983 3:44105824-44105846 CGGGCAGTCTCAGGCTTGCCAGG + Intergenic
954533724 3:51342493-51342515 GGGGCAGCTCCAGGTTAGCCAGG - Intronic
954800131 3:53182458-53182480 GGGGCTTTGTCATGTTGGCCAGG + Intronic
956283550 3:67584806-67584828 GGGGCTCTTCCTGCTTTGCCCGG - Intronic
959755407 3:109892127-109892149 GGGGTTTTGTCATGTTTGCCAGG + Intergenic
963029362 3:140952207-140952229 GGGGTTTTATCATGTTTGCCAGG + Intronic
964503914 3:157377647-157377669 GGGGCTGTTTCTGCTTTGCTTGG + Intronic
966422909 3:179751525-179751547 GGGGGTGTTTCAGGATCACCTGG + Intronic
967648006 3:191950258-191950280 GGGGCTGCTCCAGGCTGGCCTGG - Intergenic
968121599 3:196129810-196129832 GGGGTTTTTCCAGGTTGGCCAGG - Intergenic
969666042 4:8558099-8558121 GGAGCTGGTTCAGGTGTGCTTGG + Intergenic
972707981 4:41564324-41564346 GAGGCTATTTCAGGTTTTCCTGG + Intronic
974018916 4:56675854-56675876 GGGGCTGCTTCAGGATCCCCAGG + Intronic
974759892 4:66261369-66261391 GGGGTTTTTTCATGTTGGCCAGG + Intergenic
978273993 4:106926647-106926669 GGGGCTATTTCAGGTCTGTAAGG - Intronic
978571871 4:110146796-110146818 GGGGTTTTCTCAGGTTGGCCAGG - Intronic
979928373 4:126596551-126596573 GAGCCTGTTTCAAGTCTGCCTGG - Intergenic
980140991 4:128917015-128917037 GTGGCTGTTTCTGGTTTGGTTGG - Intronic
981709735 4:147697318-147697340 GGGTCTTTTTCAGCTTTCCCGGG - Intergenic
983908834 4:173214065-173214087 GAGATTGTTTGAGGTTTGCCTGG - Intronic
985421200 4:189786632-189786654 GGGGCTGTGGCAGGTTTGGAAGG - Intergenic
985569615 5:637870-637892 GGGGCTGTTACGGCTTTGGCGGG + Intronic
985651297 5:1109009-1109031 GGGGCTCTCCCAGGTTTGCCGGG - Intronic
986923620 5:12718040-12718062 GAAGCTGTTTGAGGTATGCCTGG + Intergenic
990583667 5:57189308-57189330 GGGGCTTTGTCATGTTGGCCAGG + Intronic
994927704 5:106139740-106139762 TGGGCTGTTTCTAGTTTTCCTGG - Intergenic
996456409 5:123688157-123688179 GGGTCTGTTTCAGGGATGCAAGG + Intergenic
998377537 5:141701323-141701345 GGGGCTGTTTCAGCAATACCAGG - Intergenic
998858423 5:146418807-146418829 GGGGTTTTTTCATGTTGGCCAGG + Intergenic
999412190 5:151360507-151360529 GGTGCTGTTTCAGGGGTGGCAGG + Intergenic
1000191946 5:158919614-158919636 GGTTCTGTTTCAGGTTTCCCAGG - Intronic
1000335600 5:160239175-160239197 GAAGCTGTTTCAGCTTGGCCGGG + Intergenic
1001889234 5:175325178-175325200 GGGGCTGTTTCCCCTTTGCTCGG + Intergenic
1005884578 6:30086880-30086902 GGGGTTTTGTCATGTTTGCCAGG + Intergenic
1007486405 6:42183868-42183890 GGGACTGTTTCAGCTCTGCCTGG - Intergenic
1009042356 6:58194093-58194115 GGGGCTTCTTCATGTTGGCCAGG + Intergenic
1009218197 6:60948317-60948339 GGGGCTTCTTCATGTTGGCCAGG + Intergenic
1010363372 6:75021024-75021046 GGAGCTGTTTCAAGTTTACTTGG - Intergenic
1016422801 6:143902245-143902267 GGGGTTGTTTCAGTTTTGAAGGG + Intronic
1017748634 6:157469573-157469595 GTGGCTGTTGCAGGTCAGCCTGG + Intronic
1019786762 7:2982137-2982159 TGGGTTGTTTCCTGTTTGCCTGG + Intronic
1020124655 7:5526753-5526775 GGGGCTGTCTCAGGGTAGCTGGG - Intergenic
1021803295 7:24329665-24329687 GGAGCTGTTCCAGGTTTGGAGGG - Intergenic
1023431851 7:40101514-40101536 GGGGCTTTATCATGTTGGCCAGG + Intergenic
1023625232 7:42108912-42108934 GAGGGTGTTTCAGGTTAGGCTGG - Intronic
1028151723 7:87381331-87381353 GGGGCTGTTTCAGGTTTGCCAGG - Intronic
1028378812 7:90175996-90176018 GAAGCTGCTTCAGGTATGCCTGG - Intronic
1028773134 7:94650131-94650153 CTGTCTGTTTCAGGTTAGCCTGG - Intronic
1029614907 7:101650177-101650199 GGGGCAGGTTCAGGGATGCCTGG + Intergenic
1030447835 7:109669802-109669824 GGGGCAGATTCAGGTATGCTAGG + Intergenic
1035179625 7:157079807-157079829 GGGGTTTTTTCATGTTGGCCAGG - Intergenic
1037935397 8:22912067-22912089 GGGGCAGGTTCAGGTCTGGCAGG + Intronic
1038491242 8:27973283-27973305 GGGGTTTTTTCATGTTGGCCAGG - Intronic
1040022347 8:42752061-42752083 GGGGTTGCTTTAGGCTTGCCTGG + Intergenic
1040826772 8:51630585-51630607 GGGGTTGTTTGTGGTTTGCTTGG - Intronic
1042553277 8:70013187-70013209 GGGGCTTCTTCACGTTGGCCAGG + Intergenic
1043270107 8:78322598-78322620 GGGGTTTTGTCATGTTTGCCAGG + Intergenic
1044569429 8:93700662-93700684 CGGGCTGTTACCGGTTTTCCAGG - Exonic
1044906950 8:97014457-97014479 GGGGCTTTGTCATGTTTGCCAGG - Intronic
1044976648 8:97671649-97671671 GGGGCTTCTTCATGTTGGCCAGG - Intronic
1044982711 8:97732376-97732398 GGGGTAGTTTCATGTTGGCCAGG - Intergenic
1047078287 8:121430481-121430503 GGGAAAGTTTGAGGTTTGCCTGG + Intergenic
1047476718 8:125239415-125239437 GGGGCTTTATCATGTTGGCCAGG - Intronic
1048367859 8:133754035-133754057 GGGGCTGCTTCTGCCTTGCCAGG + Intergenic
1048581022 8:135729949-135729971 GAGGCAGTTGCAGGTGTGCCAGG + Intergenic
1049217072 8:141413141-141413163 GGGGCTGTGCCTGGTGTGCCAGG + Intronic
1049413981 8:142487159-142487181 TGGGCTGTGGCAGGTGTGCCCGG - Intronic
1057905583 9:98980526-98980548 GGGGCTGTGTCAGGCATGTCAGG + Intronic
1059246677 9:112855325-112855347 GGGACTGTCTCAGGAGTGCCGGG + Intronic
1060946831 9:127574640-127574662 TGGTCTATTTCAGGTTTGACAGG - Intronic
1061607658 9:131723405-131723427 GGGACTATTTCAGTTTTGCAAGG - Intronic
1061734468 9:132644091-132644113 GGGACTGTTTCAGCTTAGTCTGG + Intronic
1191872320 X:65758774-65758796 GGGTCTGTTTCATGTATGCTTGG - Intergenic
1192446475 X:71215113-71215135 GGGGCTGGTTAATGTTTGTCTGG + Intergenic
1194811241 X:98389643-98389665 AGGGCTTTTTCAAGTATGCCTGG + Intergenic
1197123151 X:122914643-122914665 GGGGCTATTTGGGGTTTTCCTGG + Intergenic
1197798955 X:130328911-130328933 GGGACTGTTTCTGGTTCGCTGGG + Intergenic
1201344137 Y:12964875-12964897 GGGGCTGTTGTAGGCTTTCCTGG + Intergenic