ID: 1028154137

View in Genome Browser
Species Human (GRCh38)
Location 7:87410305-87410327
Sequence TCTTAGCTTTAGAAATTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 362
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 338}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028154137_1028154145 19 Left 1028154137 7:87410305-87410327 CCTTCAAATTTCTAAAGCTAAGA 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1028154145 7:87410347-87410369 TACCTAGGGGCTGGGATGAGAGG 0: 1
1: 0
2: 2
3: 95
4: 2264
1028154137_1028154139 -10 Left 1028154137 7:87410305-87410327 CCTTCAAATTTCTAAAGCTAAGA 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1028154139 7:87410318-87410340 AAAGCTAAGATATTAAAAATGGG 0: 1
1: 1
2: 1
3: 77
4: 806
1028154137_1028154141 5 Left 1028154137 7:87410305-87410327 CCTTCAAATTTCTAAAGCTAAGA 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1028154141 7:87410333-87410355 AAAATGGGTTTTAATACCTAGGG No data
1028154137_1028154142 6 Left 1028154137 7:87410305-87410327 CCTTCAAATTTCTAAAGCTAAGA 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1028154142 7:87410334-87410356 AAATGGGTTTTAATACCTAGGGG 0: 1
1: 0
2: 1
3: 26
4: 305
1028154137_1028154143 10 Left 1028154137 7:87410305-87410327 CCTTCAAATTTCTAAAGCTAAGA 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1028154143 7:87410338-87410360 GGGTTTTAATACCTAGGGGCTGG No data
1028154137_1028154144 11 Left 1028154137 7:87410305-87410327 CCTTCAAATTTCTAAAGCTAAGA 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1028154144 7:87410339-87410361 GGTTTTAATACCTAGGGGCTGGG 0: 1
1: 0
2: 5
3: 127
4: 1671
1028154137_1028154140 4 Left 1028154137 7:87410305-87410327 CCTTCAAATTTCTAAAGCTAAGA 0: 1
1: 0
2: 2
3: 21
4: 338
Right 1028154140 7:87410332-87410354 AAAAATGGGTTTTAATACCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028154137 Original CRISPR TCTTAGCTTTAGAAATTTGA AGG (reversed) Intronic
900972193 1:5997888-5997910 TCTTAGCAGCAGACATTTGAAGG + Intronic
908133943 1:61108778-61108800 TCTTATTTTTAAAAATTTTATGG + Intronic
908241974 1:62195446-62195468 TCCTAGCTTTAGAAAAAGGATGG + Intronic
909025847 1:70480887-70480909 TTTTATCTTTAAAAATTTAAAGG - Intergenic
909143752 1:71901238-71901260 TCTTAGGTTAATAAATATGAAGG - Intronic
909163546 1:72186093-72186115 TATTTCCTTTACAAATTTGAGGG - Intronic
911198843 1:95023422-95023444 TCATAGCAGTAGAAAGTTGATGG - Intronic
911660205 1:100493124-100493146 TTTTATATTTAGAATTTTGAAGG + Intronic
912854433 1:113154471-113154493 TCTGAGCTTCAAAAATTTAAAGG + Intergenic
913127644 1:115807887-115807909 TCTTAGCTTTTGTAAACTGAAGG + Intergenic
913283044 1:117203612-117203634 TCTTACCTGTAGAAACTTCATGG + Intronic
915790930 1:158670301-158670323 TCTGAGCTCTAGCAATTTGGGGG - Intronic
916339893 1:163721078-163721100 TTTTAGCCTTACAAATCTGAAGG + Intergenic
916865885 1:168858223-168858245 TATTAATTTTAAAAATTTGAAGG + Intergenic
916900971 1:169223112-169223134 TCTAATCTTTAGAAATATAAAGG - Intronic
916945297 1:169720183-169720205 TCTTAGCCTTAGAATTTTGGGGG + Intronic
917380067 1:174396679-174396701 TCATACCTTTAAAAATTTTAAGG + Intronic
918723721 1:187890093-187890115 TATTATCTGTAGAATTTTGAAGG + Intergenic
919246100 1:194986767-194986789 TCTTATATTTATAAATTTAAAGG + Intergenic
919426172 1:197433879-197433901 TATTAGGTTTACAGATTTGATGG + Intronic
919885383 1:201930130-201930152 TCGTAGCTTGAGAAATAGGAAGG + Intronic
921882059 1:220266726-220266748 TCTTTGTTTTGGCAATTTGATGG + Intronic
923414080 1:233737792-233737814 TCTTTGCTTTACAAATATGCTGG - Intergenic
923793260 1:237128927-237128949 TCTTAGCCTAAGCGATTTGAAGG + Intronic
923877235 1:238062582-238062604 TAATAGCTTTGGAACTTTGAGGG + Intergenic
924817923 1:247459166-247459188 TCTTATCTGTATAAATTTAAGGG + Intergenic
1063608117 10:7540817-7540839 TCTTTGCTTTAAAAATATAAAGG - Intergenic
1063700418 10:8379062-8379084 TCTTCGCTTTTGAAAATAGATGG + Intergenic
1065554751 10:26904267-26904289 ACTTATCTTTAGTTATTTGAAGG - Intergenic
1065762596 10:28996305-28996327 TCCTAGCTTTAGCAACTTGGGGG + Intergenic
1066348077 10:34608832-34608854 TGTTAGTTTTAAAAATTTGTAGG - Intronic
1066406525 10:35124526-35124548 TCTTCTCTTGAGAAATCTGAAGG + Intergenic
1066550228 10:36547758-36547780 TTTTGGCTTGAGAAATTAGAAGG - Intergenic
1066555369 10:36607182-36607204 TATTAGATTTAGAAATTATATGG - Intergenic
1068003607 10:51366636-51366658 TCTTAGTTCTATGAATTTGAAGG - Intronic
1068016196 10:51518897-51518919 TCTTAGCTATAAGGATTTGAAGG + Intronic
1068916881 10:62442548-62442570 TGTTACCTTTAGAAGTTTGGAGG + Intronic
1069166206 10:65163647-65163669 TGTTAGCTTTAGAATCTGGAGGG - Intergenic
1069264439 10:66440149-66440171 TCTCCACTTTAGATATTTGAAGG + Intronic
1071982361 10:91016175-91016197 TCTTAGATTTAGAAATGTCTAGG - Intergenic
1073898376 10:108189547-108189569 TCTTATATTTAGAAAATTTAGGG + Intergenic
1074542698 10:114378669-114378691 TCTTGGCTTTAGTATTTTGGGGG - Intronic
1075984249 10:126769834-126769856 TCTTAGCAATAGGAGTTTGAAGG - Intergenic
1077201957 11:1312851-1312873 TCTTCTTTTTAGAAATTTGTAGG - Intergenic
1077715117 11:4573066-4573088 TCTCAACTTAAGAATTTTGAGGG - Intronic
1081280487 11:41203636-41203658 TCTTAGCTCTACGAATTTGTGGG + Intronic
1081398977 11:42620525-42620547 ACTTAGAATTAGAAATTAGAAGG - Intergenic
1082930222 11:58595440-58595462 TCTCATCTTTTGGAATTTGATGG + Intronic
1083496373 11:63057846-63057868 TGATTGCTTTTGAAATTTGAGGG - Intergenic
1085378594 11:76091287-76091309 TTTTATTTTTAGAAATTTGTAGG + Intronic
1085499934 11:77010825-77010847 ATTTTCCTTTAGAAATTTGAAGG - Intronic
1086991459 11:93308098-93308120 TGTTAGCTTAAGAAGTTTTAGGG - Intergenic
1087574581 11:99974593-99974615 TCCTAGTTTCATAAATTTGATGG - Intronic
1087863129 11:103188976-103188998 TGTTATCTTCATAAATTTGATGG - Intronic
1088000321 11:104871987-104872009 TCCTATTTTTAGAAATTTTAAGG + Intergenic
1088208760 11:107428130-107428152 AATTTGCTTTAGAAATTTGCTGG - Intronic
1090415774 11:126539417-126539439 TCTGAGTTTTAGAAATATCACGG + Intronic
1092938254 12:13383977-13383999 TGTCAGCTTTAGAAAAATGAGGG + Intronic
1093111039 12:15152414-15152436 TCTAGGCTTTTGAAATTAGAGGG - Intronic
1094016315 12:25868122-25868144 TTTCATCTTTAGAAATTTTAAGG - Intergenic
1094151711 12:27291899-27291921 TTCTTCCTTTAGAAATTTGATGG + Intronic
1097551787 12:61080648-61080670 TCAAAGCTTTAGAAAATGGAAGG + Intergenic
1098048259 12:66425169-66425191 TCCTTCTTTTAGAAATTTGAAGG + Intronic
1098720617 12:73892747-73892769 TCTAATATTTAGAAATATGAGGG - Intergenic
1098970126 12:76845444-76845466 TCTTAGCTTTTGTAAATTGATGG + Intronic
1100765799 12:97864170-97864192 TCTAAGCTTCAGAATTGTGAGGG - Intergenic
1101888055 12:108686416-108686438 TCTAAGCTTTAGAAGATTGGTGG - Intronic
1102202132 12:111064554-111064576 TCTTCTTTTTAGAAATATGATGG + Intronic
1102414876 12:112752218-112752240 TCTTACATTTAGAAAACTGAGGG - Intronic
1106745648 13:32703385-32703407 TCTTGGCTTTAGGAATCAGAAGG + Intronic
1107148852 13:37089295-37089317 TTTTAGTTTTATAAATTGGAGGG + Intergenic
1109831513 13:67796877-67796899 TTGTAGCTTAAGAAATTTTATGG + Intergenic
1110152916 13:72276605-72276627 GATTAGATTTAGAAATTAGAAGG - Intergenic
1110490714 13:76102369-76102391 TCACAACTTTTGAAATTTGATGG - Intergenic
1110639110 13:77801491-77801513 TCTTAATTTTATAAAATTGAAGG + Intergenic
1111350335 13:87020312-87020334 TTTTGGATTTAGAACTTTGATGG + Intergenic
1111532253 13:89553052-89553074 TATTAGCTTTAGAAAGTTCTTGG - Intergenic
1111721712 13:91954843-91954865 GATTAGCTTTGGAAATTTTAGGG - Intronic
1111773363 13:92627234-92627256 TTTCACCTTTAGCAATTTGAGGG + Intronic
1112907949 13:104447217-104447239 TCACAGATTTAGAAATTTGGGGG - Intergenic
1114985770 14:28226742-28226764 CCTTGGCTTTAGAAGATTGATGG - Intergenic
1115179228 14:30602976-30602998 TCTTCCCTTTAGAAAGTTTAAGG + Intronic
1115348509 14:32368050-32368072 TCTTTTTTCTAGAAATTTGAAGG + Intronic
1115410740 14:33071854-33071876 TCTCTTCTTCAGAAATTTGATGG - Intronic
1115840711 14:37467472-37467494 TGTTAGCCTGTGAAATTTGAAGG - Intronic
1115962274 14:38849073-38849095 TCTTAGTTTTGGAAACTTGTTGG - Intergenic
1116008038 14:39317538-39317560 TGTCAACTTTAGAGATTTGAGGG + Intronic
1117242324 14:53847036-53847058 TCTTAGCATTATAATTTTTATGG + Intergenic
1117306261 14:54477427-54477449 TCTTAGTCTTAGAAATTGGTGGG - Exonic
1117867881 14:60168134-60168156 TCTTACCTTTAGTAATCTCATGG + Intronic
1118235761 14:64003935-64003957 TTTTAGCTTTTGGAATCTGAAGG - Intronic
1119124060 14:72108024-72108046 TCTTAGTTTCATATATTTGATGG + Intronic
1119166028 14:72493792-72493814 TCTTTCCTTTAGAAATTTGTAGG - Intronic
1120234966 14:81880256-81880278 TTTTTTCTTGAGAAATTTGAAGG + Intergenic
1120317246 14:82911249-82911271 ACTTGTCTTCAGAAATTTGAGGG - Intergenic
1120424571 14:84330584-84330606 TCTAAGTTTTATAAATTTGATGG + Intergenic
1121551001 14:94800398-94800420 GCTTTGCTTTAGAAATTGTAGGG - Intergenic
1123154397 14:106210447-106210469 TCCTAGCTTGAGAAAATTAATGG - Intergenic
1123180957 14:106469774-106469796 TCCTAGCTTGAGAAACTTGATGG - Intergenic
1125041823 15:35196600-35196622 TCTTTGATTCTGAAATTTGATGG + Intergenic
1125045055 15:35235707-35235729 TTTTAGCTTTTGAAAATGGAGGG + Intronic
1125292222 15:38162651-38162673 TCTGAGCTTCAGAATTTTGATGG - Intergenic
1127135902 15:55923340-55923362 ACTTAGCCTTAAAAATTAGATGG + Intronic
1127167147 15:56256668-56256690 TATCAGCATTAGAAATTAGAAGG + Intronic
1128210502 15:65897381-65897403 TCTTGGCTGTTGTAATTTGATGG + Exonic
1130154881 15:81341673-81341695 TCTTATCTTTAGAAGGTGGAGGG - Intronic
1130358072 15:83153347-83153369 TATGAGCATTAGAAATTTTAGGG - Intronic
1130742224 15:86613046-86613068 TCTTGGCTTTATACATTTTAGGG - Intronic
1131939595 15:97546296-97546318 TCTCAGCTTTCAAAATTTCATGG - Intergenic
1131959180 15:97770489-97770511 TTTGAGCTTTAGATATTAGATGG + Intergenic
1136998826 16:35210665-35210687 TCTTAGGATCAGAAGTTTGATGG - Intergenic
1137029770 16:35511065-35511087 TCTTAGGATCAGAAGTTTGATGG + Intergenic
1137328470 16:47465385-47465407 TCTTGGGTTTAGAAATTTTCAGG - Intronic
1140121899 16:72091138-72091160 TCTCAACTTTGGTAATTTGAAGG + Intronic
1141455382 16:84137773-84137795 TATGAGCTTTTGAAATTTGGTGG - Intronic
1143803812 17:9408536-9408558 TCTTAGGTCCAGAACTTTGATGG - Intronic
1143928216 17:10392351-10392373 TCTAAACTTTAGAAATCTGAAGG + Intronic
1145327839 17:21845943-21845965 TATTATCTTTAGAAGTTTTATGG + Intergenic
1145694653 17:26777323-26777345 TATTATCTTTAGAAGTTTTATGG + Intergenic
1147392031 17:40115430-40115452 GGTTAGTCTTAGAAATTTGACGG + Intergenic
1150049185 17:61942325-61942347 GCTAAGCTTTAAATATTTGAAGG + Intergenic
1151144100 17:72023375-72023397 TCTCAGCTTTACAAAATAGAGGG - Intergenic
1203192473 17_KI270729v1_random:202171-202193 TATTATCTTTAGAAGTTTTATGG + Intergenic
1203201838 17_KI270730v1_random:1606-1628 TATTATCTTTAGAAGTTTTATGG + Intergenic
1154040028 18:10845864-10845886 TTTTTGCTTTAGAAAAATGATGG - Intronic
1154360225 18:13654561-13654583 GCTTAGCTTCAGAAGTTGGAGGG - Intergenic
1156956635 18:42973873-42973895 TTTTATTTTTAGAAAATTGAGGG + Intronic
1157215512 18:45780012-45780034 TATTAGCTTTTGATATTTTAGGG + Intergenic
1157532775 18:48435979-48436001 TTTAAGCTTCAGAATTTTGACGG - Intergenic
1159582950 18:70253243-70253265 CATTTGCTTTAGAAATTTGGGGG + Intergenic
1160393926 18:78558481-78558503 CCTCAGCTTTAGACCTTTGAGGG + Intergenic
1166342259 19:42145520-42145542 TCTGAGCTCTGGACATTTGAAGG + Intronic
925074194 2:998916-998938 TGATAGGCTTAGAAATTTGATGG - Intronic
925621569 2:5798678-5798700 TTTTTTCTTCAGAAATTTGAAGG + Intergenic
926658181 2:15433227-15433249 TCATAGCTGTAGAACCTTGATGG + Intronic
928629650 2:33177881-33177903 TCTAGGCTTTACAAATTTGTGGG + Intronic
929242751 2:39668362-39668384 TCTCAGCTTTATAATATTGATGG + Intronic
929843061 2:45491506-45491528 TCTAAACTATAGCAATTTGAAGG - Intronic
930206464 2:48591981-48592003 TCTCAGCTATGGAAACTTGATGG + Intronic
931581007 2:63774596-63774618 GTTTAGCTTTTGACATTTGAAGG - Intronic
932698075 2:73973582-73973604 TCTTTGTTGTAGAAATTTTAGGG + Intergenic
932895577 2:75636460-75636482 TCATATTTTTAGAAACTTGAAGG + Intergenic
933028165 2:77289326-77289348 TCTCAGATTTAGAAATGTTAGGG - Intronic
933088398 2:78086972-78086994 TTTTAGCCTTAGAAATCGGAAGG + Intergenic
933094966 2:78166631-78166653 TCCTTTCTTTAGAAATTTGGAGG + Intergenic
933675752 2:85055832-85055854 TCTGGTCCTTAGAAATTTGAAGG - Exonic
935639687 2:105279097-105279119 TCTTATCTTTAAAAATGAGAGGG - Intronic
936836479 2:116716728-116716750 TATTAACTGTAGAGATTTGAAGG + Intergenic
936860314 2:117009353-117009375 TTTTAGCTTTATAAATATCAAGG + Intergenic
937486070 2:122316077-122316099 CCTTTGCTTTAGAAACTTGCAGG + Intergenic
937601980 2:123748548-123748570 TGTAAGCTTTGGAAACTTGAAGG - Intergenic
938222614 2:129583423-129583445 TCTTATCTCTATAAATATGATGG + Intergenic
938633905 2:133201829-133201851 TCTGCGCTTAAGAAAGTTGAAGG + Intronic
939750189 2:146034688-146034710 TGTTAGACTTAGAAATTTAAAGG + Intergenic
940250878 2:151674929-151674951 GGTCAGCTTTAGAAATTTTAGGG + Intronic
940892377 2:159047439-159047461 TTTTAGCTTTAGCGATTTGGGGG - Intronic
941012593 2:160318116-160318138 TGATAGCTTTAGAAAAATGATGG - Intronic
941262051 2:163309597-163309619 TCATATATTTAGTAATTTGATGG + Intergenic
941825427 2:169889859-169889881 TTTCTGCTTTAGAAATTTGATGG + Intronic
942330507 2:174818666-174818688 TATTAACTTGAGAAATTGGAAGG - Intronic
942514509 2:176737821-176737843 GCTTAGCTTCAGAAATATTAAGG - Intergenic
947300378 2:228682433-228682455 TCTTATCTTTAGAAAATAGGGGG + Intergenic
947792375 2:232875790-232875812 TCTTAGCCTGGGAAATGTGAGGG + Intronic
948320878 2:237068204-237068226 GCTTGGCTTTAGAAATTTCCTGG + Intergenic
948682018 2:239641582-239641604 TCTTAGATATAGTAATTTGAAGG - Intergenic
1170187559 20:13608025-13608047 TCTCAGCTTTAGAAGGTTAAAGG - Intronic
1170700975 20:18703196-18703218 TCTTTGCTTCAGAATTCTGAAGG + Intronic
1171177680 20:23065692-23065714 TATTTGCTTTAGCAATCTGATGG + Intergenic
1171518114 20:25754748-25754770 TATTATCTTTAGAAGTTTTATGG + Intergenic
1171558745 20:26101459-26101481 TATTATCTTTAGAAGTTTTATGG - Intergenic
1173349999 20:42235988-42236010 TCTTATTTTTAGAGATGTGAAGG - Intronic
1173360320 20:42338380-42338402 TCCTGGCTTTGGAAATATGATGG + Intronic
1175075614 20:56370180-56370202 TCTTTGTTTTGGCAATTTGATGG + Exonic
1175860038 20:62145037-62145059 TGCTAGTTTTAGAAATTTGATGG + Intronic
1177394257 21:20512213-20512235 TATTCGCTTTGGAAAATTGATGG - Intergenic
1178905972 21:36636785-36636807 ACTTACCTTCAGAACTTTGAAGG + Intergenic
1179014444 21:37583495-37583517 TCTTACCTCTGGAGATTTGAAGG - Intergenic
1179164111 21:38922025-38922047 TCTCAACTGTAGAAATGTGATGG + Intergenic
1182638040 22:31744613-31744635 TCTAAGCTCTAGAATATTGATGG - Intronic
1183879539 22:40815554-40815576 ACCTAGTTTTAGAAATTTAAGGG - Intronic
949326649 3:2873492-2873514 TCTTAAATTTAGAAGTTTGTGGG - Intronic
951988627 3:28650053-28650075 TCTTAGCTTTAGTGCTTTTAAGG + Intergenic
952055792 3:29443891-29443913 TCTTAGCTTGAGCATCTTGAGGG + Intronic
952778033 3:37065365-37065387 TCTTGGCTTAAGAAATGTGGTGG + Intronic
953266281 3:41392181-41392203 CTTTAGCTTTAAAAATGTGATGG - Intronic
955541157 3:59977691-59977713 TCTTTGCTTTAGATTTTTTAAGG - Intronic
956669547 3:71673518-71673540 ACTCAGCTTTAGAAATCTAAGGG + Intergenic
957274618 3:78074933-78074955 TCTCAGTTCTAGAAATTGGAAGG + Intergenic
957677452 3:83386943-83386965 TATTAACTTTAATAATTTGATGG - Intergenic
958714003 3:97755972-97755994 TCCTACCTTTAGTAATTTGTAGG + Intergenic
958773462 3:98453923-98453945 ACCTAGCTTTAGAAATCTGGTGG - Intergenic
958975567 3:100664377-100664399 TCTTAGTCTTAGAAATTGGTGGG - Intronic
959210630 3:103375342-103375364 TTTTAGCTTTATAAATTCTATGG + Intergenic
959986366 3:112576727-112576749 TTTCAGCTTTAAAAATTGGAAGG - Intronic
960897118 3:122516427-122516449 CCTTAGCTTTGGAAAAATGATGG + Intergenic
960921967 3:122756331-122756353 ATTTTGCTTTGGAAATTTGAAGG + Intronic
960999292 3:123362390-123362412 TATTTGCTTTACAAATTTAAGGG - Intronic
961422654 3:126818591-126818613 TCTTAACTGGAGAAATGTGAAGG - Intronic
961487269 3:127225799-127225821 ACTTTCCTTTAGAATTTTGAAGG - Intergenic
962955025 3:140257140-140257162 TATTTGCTTTACAAGTTTGAAGG - Intronic
963446608 3:145418021-145418043 TCTTTGTCTTTGAAATTTGAGGG + Intergenic
963455273 3:145538649-145538671 TTTTACCTTTAGTATTTTGATGG - Intergenic
963487078 3:145948342-145948364 TCTTAGCTTAAGAAACTTTTGGG - Intergenic
963877693 3:150494955-150494977 TTGTAACTTTAGAAATTTGGGGG - Intergenic
964571924 3:158117177-158117199 TTTTATCTTTAGAAATTTCTAGG + Intronic
965412089 3:168344821-168344843 TCTTGGACTTTGAAATTTGATGG + Intergenic
965654109 3:170965469-170965491 TCTGAGCTGTACAAAGTTGATGG - Intergenic
966876665 3:184326003-184326025 TCTCAACTTTAGAAAAGTGAAGG - Intronic
967391894 3:188964374-188964396 TCTAAGCACTAGAAATATGAAGG - Intronic
967483679 3:190004873-190004895 TTTTAGCTGTAGTAAATTGATGG - Intronic
967854231 3:194104393-194104415 TTGTAGCTTTAAAGATTTGATGG - Intergenic
970829694 4:20322284-20322306 GCTTGGCTTTAGACATTTTAGGG + Intronic
970908559 4:21246634-21246656 TGTTAGCCTTAGAGATTGGAAGG + Intronic
972071661 4:35027222-35027244 TTTTAGCTGTAGGAATTTGATGG + Intergenic
972627062 4:40809720-40809742 TCTTAGAATCAGAAATTTGTGGG - Exonic
972673644 4:41238158-41238180 TTTTCGCTTTATACATTTGAGGG + Intergenic
973315867 4:48759555-48759577 TCTTGGCTTTAGAAGTTTAGAGG + Intronic
974000819 4:56509146-56509168 TATTAGCCTTAGAATTTTTATGG - Intronic
974887564 4:67839224-67839246 TCTAAGCTTCAGAAATTAGCTGG + Intronic
975318358 4:72980882-72980904 GCTTAGTTGTAGAAAATTGATGG - Intergenic
975797602 4:78025501-78025523 ACTTGGCTTTATAAATTTTAGGG + Intergenic
977968469 4:103184592-103184614 TCTTTTCTTTACAAATTTGAAGG + Intronic
978048138 4:104159171-104159193 TCTTAGCTTTTTCAATTTGTTGG - Intergenic
979450036 4:120859789-120859811 TCTTGCCTTCAGAAATTTGAAGG - Intronic
980342095 4:131563895-131563917 TCTAAGCTTTAGAACGTTGTAGG - Intergenic
980645627 4:135638822-135638844 TTTTTTTTTTAGAAATTTGAAGG + Intergenic
982085217 4:151828706-151828728 TTTTTGCTTTTTAAATTTGATGG - Intergenic
982159513 4:152553679-152553701 CTTTAGCATTAGAAATTTGGGGG + Intergenic
982368583 4:154607878-154607900 TTTTTGCTTGAGATATTTGAAGG - Intronic
983902335 4:173148523-173148545 TCTTATTTCTATAAATTTGAAGG - Intergenic
984402464 4:179284706-179284728 GCTTACGTTTAGAAATTGGAAGG + Intergenic
984535825 4:180974148-180974170 TCTTAGCTGTTCATATTTGATGG - Intergenic
986748262 5:10762252-10762274 TCTTGGTTTTATACATTTGAGGG - Intergenic
987594335 5:19976742-19976764 TCTTATCCTTTGAAATTTGTAGG - Intronic
987684823 5:21183447-21183469 TGTTTGTTTTAGAAAATTGAGGG - Intergenic
988111594 5:26829630-26829652 TCATAGTTTTAGATATTTGTGGG - Intergenic
988129539 5:27085067-27085089 TGTTAGATTTAGAAGTATGATGG - Intronic
988258775 5:28855909-28855931 CCTGACCTCTAGAAATTTGAGGG - Intergenic
989012616 5:36890701-36890723 TCTCAGCTTTTGAGATTTCATGG + Intronic
989759688 5:44998787-44998809 CCTTTGCTTTTCAAATTTGATGG - Intergenic
990101825 5:52200543-52200565 TCTTAGCTATAATGATTTGAAGG - Intergenic
990771290 5:59248947-59248969 TCTTTGCTTTAATAATTTGAGGG - Intronic
993259232 5:85638228-85638250 TTTTGGATTTAGAAATTTTAAGG - Intergenic
993876455 5:93312946-93312968 TTTTAGCTTAGGAATTTTGAAGG - Intergenic
997612333 5:135223951-135223973 TCTTGGCTTGAGCAATTGGATGG - Intronic
998732776 5:145099642-145099664 TTTCAGCTGAAGAAATTTGAGGG - Intergenic
999991123 5:157050930-157050952 TCTTAGCTGGAAAAATCTGATGG - Intronic
1000076611 5:157794204-157794226 TCCCAGTTTTAGAAAGTTGAAGG + Intronic
1004110210 6:12710334-12710356 CCTTAGCTTTTCAAATTAGATGG - Intergenic
1004492726 6:16130957-16130979 TCTTGTCTTTATAAACTTGATGG + Intronic
1005764946 6:29002081-29002103 CTTTAGCTTTAGAAATTGAAAGG + Intronic
1006339595 6:33439463-33439485 GATTAGCTTTAGAAACTGGAAGG + Intronic
1008900819 6:56613533-56613555 TCTGACGTTTAGAAATTTCAAGG - Intronic
1008950365 6:57151557-57151579 TATTAGTTTTAAAACTTTGAGGG - Intronic
1009404273 6:63292841-63292863 TCTTAGTTTTGGTAATTTGCTGG - Intronic
1009520588 6:64677854-64677876 TCTTAGCATTAGTAATTAAAGGG - Intronic
1010550281 6:77213406-77213428 CCCTAGCTTTGGAAGTTTGAAGG - Intergenic
1010752013 6:79626404-79626426 TCTCCTCTTTGGAAATTTGATGG - Intergenic
1011241539 6:85276666-85276688 TCTTACTTTTGGCAATTTGAGGG + Intergenic
1011553636 6:88551878-88551900 TTTTACCTTTAGAAATTTCGAGG + Intergenic
1011905212 6:92357512-92357534 TATTATTTTTAGAAATGTGATGG + Intergenic
1012235369 6:96807835-96807857 TGTTAGCTTTAAAAATTCCACGG + Intronic
1012302394 6:97605710-97605732 TCATAGCTTCTGTAATTTGAGGG + Intergenic
1012779495 6:103539605-103539627 TCTTCACTTTTGAAATTTCAGGG - Intergenic
1013296577 6:108762979-108763001 TATTGGATTTAGAAATTTGGAGG - Intergenic
1014788725 6:125646597-125646619 TATCAGCTTTAGAATTTTGGGGG - Intergenic
1014959329 6:127663049-127663071 CCATAGCTTTAGAAATTTCTTGG - Intergenic
1015883864 6:137896432-137896454 TCTAATATTAAGAAATTTGATGG + Intergenic
1016078087 6:139821318-139821340 GCTAAGCTGTAGAAATTTTAAGG + Intergenic
1017476912 6:154804918-154804940 TATTAGTTTTATAAATTTTATGG + Intronic
1017557244 6:155584429-155584451 TCCTAGCTTTTGAATTTTAAGGG - Intergenic
1017997322 6:159543429-159543451 TCTTTTCTTTACAAATTTCACGG + Intergenic
1018571832 6:165219920-165219942 GCTTTGCTTTAGAAATAAGACGG - Intergenic
1018999391 6:168736046-168736068 TCTTATCTTCAGAAATTAGTGGG + Intergenic
1019141631 6:169950538-169950560 TCTTATTTTTAGAAAATTGCTGG + Intergenic
1020384472 7:7583196-7583218 TCTTAGCTTTACAGCTTTGTGGG + Exonic
1021012401 7:15486744-15486766 TTTTATCTTTAGAAATATCACGG + Intronic
1022167592 7:27785026-27785048 TCTTAGCTTCTCAAATTTGGAGG + Intronic
1022287297 7:28965850-28965872 TCATGGCTTTAGAAATTTGGAGG + Intergenic
1024464675 7:49699846-49699868 TCTTATCTATAGAATTGTGAAGG + Intergenic
1025278938 7:57612094-57612116 TATTATCTTTAGAAGTTTTATGG + Intergenic
1025305793 7:57853406-57853428 TATTATCTTTAGAAGTTTTATGG - Intergenic
1025983536 7:66427789-66427811 TGTTAGTTTTATGAATTTGATGG - Intergenic
1026413007 7:70145734-70145756 CCCAAGCTTTACAAATTTGATGG - Intronic
1027936937 7:84617860-84617882 TCTGAGGTTTAGAAATGTTAAGG + Intergenic
1028154137 7:87410305-87410327 TCTTAGCTTTAGAAATTTGAAGG - Intronic
1028612010 7:92722067-92722089 TCTTACATATAGAACTTTGAGGG - Intronic
1028763473 7:94522417-94522439 TTTTTGCTTTATAAATTTTAAGG - Intronic
1030531979 7:110722461-110722483 TTTTAGCTCTAGACATTAGATGG - Intronic
1030746767 7:113175082-113175104 TCTTACCTTTAGCATTGTGATGG - Intergenic
1031081156 7:117258128-117258150 ACTTAGCTTTATACATTTTAAGG + Intergenic
1031445356 7:121846570-121846592 TTTTAGTTTTAAAAATTTTATGG + Intergenic
1032044784 7:128595931-128595953 TTTTAGCTGTAAAAATTAGAAGG - Intergenic
1032805098 7:135346254-135346276 TCATAGATTTGGAAATTTGGAGG - Intergenic
1033909970 7:146250782-146250804 TCCTAATTTTAGAAATTTAAGGG - Intronic
1034045409 7:147922261-147922283 TCATACATTTAGAAATGTGAGGG - Intronic
1035623725 8:1055572-1055594 CCTTGGCTTTAGATATTTGATGG - Intergenic
1035775928 8:2188239-2188261 TCATAGCTTGAGAAAGTGGAGGG - Intergenic
1036426921 8:8653577-8653599 ACTTTCCCTTAGAAATTTGAAGG - Intergenic
1036487991 8:9196924-9196946 TTTTATCTTTAGAACTTTGAAGG + Intergenic
1036556686 8:9866217-9866239 ACTTACCTTTAAAAAATTGAGGG - Intergenic
1037117316 8:15242390-15242412 TCTTTCCTTTATAAATTTAATGG + Intergenic
1037120890 8:15285442-15285464 TATTATTTTTAAAAATTTGAAGG - Intergenic
1037194752 8:16175036-16175058 TTTTAACTTAACAAATTTGAAGG + Intronic
1037653671 8:20864342-20864364 TCTGAGCTTTAGAAACTGGCAGG + Intergenic
1038084635 8:24181166-24181188 TCTTTGCTTTTCAATTTTGAAGG - Intergenic
1038944534 8:32343388-32343410 TACTAGGTTTATAAATTTGAAGG - Intronic
1039091604 8:33835659-33835681 TCTTATCTTTTTTAATTTGAAGG - Intergenic
1039373827 8:37013551-37013573 GCTTAGCTTTATACATTTTAGGG - Intergenic
1039886620 8:41657840-41657862 TCTAAGCTTTTGAAAGGTGAGGG - Intronic
1040365479 8:46710767-46710789 TCCCAGCTTTAGAAGATTGAGGG - Intergenic
1041674178 8:60521414-60521436 TCTGAGCTTTTGAAATTACAAGG + Intronic
1042061093 8:64818840-64818862 TCTTAGCTGCAGAAATTTGAGGG + Intergenic
1043254082 8:78110895-78110917 TCTTAGCTGTAGAAAATAAAGGG + Intergenic
1043325187 8:79041662-79041684 TCATAGGTTTAAAATTTTGAAGG + Intergenic
1044975022 8:97656069-97656091 TCTTAGGTTTAGAAACTAGAAGG - Intronic
1045028078 8:98108473-98108495 TCTAAGAGTTGGAAATTTGATGG - Intronic
1045168469 8:99635055-99635077 TCTATGCTTTAGAAGTTTGTGGG - Intronic
1045428791 8:102093910-102093932 TCTTATCTTCAGGAATTTGTAGG - Intronic
1046230049 8:111343382-111343404 TGTTAGATTTATAAATTAGATGG - Intergenic
1046483111 8:114849524-114849546 GCTTAACTTTAGAAAATTTATGG - Intergenic
1047806027 8:128360680-128360702 TCCTGGCTTAAGAAACTTGATGG + Intergenic
1047873678 8:129112240-129112262 CCTAAGCTTTGTAAATTTGAGGG + Intergenic
1048808790 8:138265948-138265970 TTTAAGCTTTGGAAATTGGAAGG - Intronic
1049139567 8:140940575-140940597 GCTTAGCTTTTGAGATTGGATGG - Intronic
1050124317 9:2340793-2340815 TCTTAGCTTCTTAAATTTCAAGG + Intergenic
1050715493 9:8519902-8519924 TTTCAGCTTTAAATATTTGAAGG - Intronic
1051175373 9:14354857-14354879 CCTTAGCTTTACAGATGTGAAGG + Intronic
1051911538 9:22157891-22157913 TGTTAGCTTTAGTATTTTAAGGG + Intergenic
1052980068 9:34441626-34441648 TCTTTGCTGTACAAATGTGAAGG + Intronic
1053160214 9:35808921-35808943 TCTCAGATTAAGAAATTGGAGGG - Intronic
1053320314 9:37092481-37092503 TTTTAGCTTTATAACTTTAATGG - Intergenic
1056673729 9:88655189-88655211 TCTTATTTTTATAAATTTAAGGG - Intergenic
1057349376 9:94282347-94282369 TCTTAGTTTTATACATTTTAGGG + Intronic
1058535854 9:105959241-105959263 TCTTTGCTATACAAATTTGAGGG + Intergenic
1058784885 9:108377226-108377248 TCATAGCTTTATACATTTTAGGG + Intergenic
1060218113 9:121750590-121750612 TCTGAGCTTTCGAGATTTGGAGG + Intronic
1186081291 X:5936263-5936285 TCGTAGGATTAGAAATTTTAAGG - Intronic
1186315144 X:8361491-8361513 TCTTATCTTTAGAAATTTTATGG - Intergenic
1186400208 X:9251081-9251103 TCTTAGCTGAGGGAATTTGAAGG + Intergenic
1186540634 X:10396487-10396509 TATTTCCTTCAGAAATTTGAAGG + Intergenic
1186906323 X:14114824-14114846 TCTTAGCTATTAAAATTTCATGG - Intergenic
1188179590 X:27038210-27038232 TTTTAGCATGTGAAATTTGAGGG - Intergenic
1188388336 X:29589806-29589828 TCTTTTCTTTAGAAATTAGTTGG - Intronic
1188742576 X:33804114-33804136 TATTAGTTTTAGAAATTCCAGGG - Intergenic
1188889487 X:35592648-35592670 TCTTAGCTTTATAGATTTAGGGG + Intergenic
1189674649 X:43449220-43449242 TTTTAGTTTGAGAAATGTGAAGG + Intergenic
1191714851 X:64187243-64187265 GCTTAGCTCTAGAAATTCAAAGG + Exonic
1192791433 X:74385586-74385608 TCTTAGCTCTAGTCATTTAAGGG + Intergenic
1193681676 X:84527540-84527562 TATTTGCTTTATAAATTTGAAGG - Intergenic
1194041736 X:88949696-88949718 CCTTTGCTGTAGAAAATTGAGGG - Intergenic
1194590269 X:95791843-95791865 TCTGGGTTTTAGAAATCTGACGG - Intergenic
1194957660 X:100199784-100199806 CCTTATCTTTGGACATTTGAAGG + Intergenic
1194967749 X:100308422-100308444 TGTTACCTTTAGAATTTTTATGG - Intronic
1195511246 X:105717729-105717751 TTTTAGCTTTAGAAACTCAAAGG - Intronic
1196266010 X:113647246-113647268 CCTTTGCTTTAGTAATTTGGTGG + Intergenic
1196369839 X:114965045-114965067 TCTTAACTTTGGAAACTTCATGG - Intergenic
1196460787 X:115928019-115928041 TCTTGGCTTTTTAAATTTTATGG + Intergenic
1196816613 X:119670117-119670139 CCTTAGCTTTGGAAATTTCAAGG - Intronic
1201522480 Y:14891205-14891227 TCTTAACTTTAAAAATATGTAGG + Intergenic
1201537109 Y:15062306-15062328 TGTGAGCTTGAGAAATTTTATGG + Intergenic
1201928804 Y:19318928-19318950 TCTCAGCTTTTGAAAGTGGAGGG - Intergenic