ID: 1028154633

View in Genome Browser
Species Human (GRCh38)
Location 7:87415908-87415930
Sequence GTGGAAAGAAGCAGGATTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 441
Summary {0: 1, 1: 0, 2: 3, 3: 28, 4: 409}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028154626_1028154633 4 Left 1028154626 7:87415881-87415903 CCAACTGACCATTCTCCCATATG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1028154633 7:87415908-87415930 GTGGAAAGAAGCAGGATTGAGGG 0: 1
1: 0
2: 3
3: 28
4: 409
1028154627_1028154633 -4 Left 1028154627 7:87415889-87415911 CCATTCTCCCATATGAAATGTGG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1028154633 7:87415908-87415930 GTGGAAAGAAGCAGGATTGAGGG 0: 1
1: 0
2: 3
3: 28
4: 409
1028154625_1028154633 8 Left 1028154625 7:87415877-87415899 CCATCCAACTGACCATTCTCCCA 0: 1
1: 0
2: 2
3: 34
4: 364
Right 1028154633 7:87415908-87415930 GTGGAAAGAAGCAGGATTGAGGG 0: 1
1: 0
2: 3
3: 28
4: 409

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028154633 Original CRISPR GTGGAAAGAAGCAGGATTGA GGG Intronic
900795269 1:4703967-4703989 GTGGGGAGAAGCAGGGTAGAGGG - Intronic
900993435 1:6108158-6108180 GTGGAAAGATGGAGGGATGATGG + Intronic
901092497 1:6651337-6651359 GTGGGAAGAGGCAGGATTGAGGG - Intronic
901733869 1:11299731-11299753 GGGGGAAGAGGTAGGATTGAGGG + Intergenic
902873920 1:19329853-19329875 AGGGAAAGAGGGAGGATTGAAGG + Intergenic
903552578 1:24168225-24168247 GTGGAAAGAAGCTGGCTCGGTGG - Intronic
904388975 1:30166999-30167021 GTGGAAAGAAGCAAGAAAGTAGG + Intergenic
905338017 1:37258605-37258627 GGGGAAAGGAGCAGGGTGGATGG - Intergenic
905942543 1:41875346-41875368 GTGGCCAGGAGCAGGATGGATGG - Intronic
906169378 1:43710882-43710904 GTGGGTAGAAGCAGGATTTAAGG - Intronic
906240396 1:44239036-44239058 GTGGGAGGAAGCTGGATTGGGGG - Intronic
906766907 1:48441967-48441989 GAGAAAAGTAGCAGGGTTGAGGG - Intronic
906826982 1:48992580-48992602 GTGGGAGGAACCAGGGTTGAGGG - Intronic
907466378 1:54640486-54640508 GGGGAAAGAAGTAAGTTTGAGGG + Intergenic
907508481 1:54940448-54940470 GTGGTAAGAATTAGGATGGAGGG - Intergenic
908512388 1:64859887-64859909 AAGTAAAGAAGCAGCATTGAGGG + Intronic
909360464 1:74753270-74753292 GAGGAAAGAAGCAGTATGGATGG - Intronic
910095594 1:83518108-83518130 CTGGAAAGAAGCAGGCTTTGGGG + Intergenic
910283232 1:85524651-85524673 GGGGAAAGAAGGAGTATTAAAGG - Intronic
910551647 1:88482111-88482133 GTGGGAAAAAGCAGGATGAATGG - Intergenic
912940695 1:114042226-114042248 GTTGAAAGCAGCAGGATGAAAGG - Intergenic
913288087 1:117245872-117245894 GTAGAAAGAAGCAGAAAGGAGGG - Intergenic
913696777 1:121334211-121334233 GTGGAGAGAAGGAGGGTTCATGG - Intronic
914140783 1:144945849-144945871 GTGGAGAGAAGGAGGGTTCATGG + Intronic
914206780 1:145538330-145538352 GGGGAAAGAAGGAGTATTAAGGG + Intergenic
914464802 1:147917382-147917404 CTAGAAAGAAGCAAGATTTAAGG + Intergenic
916361489 1:163975185-163975207 GTGGGAGGAAGAAGGAGTGAGGG - Intergenic
916785148 1:168081556-168081578 GTGGAGACACACAGGATTGAGGG - Exonic
917477141 1:175378689-175378711 ATGGAAAGAAGCAGACTTGTGGG + Intronic
917676474 1:177323468-177323490 GAGAAAAGTGGCAGGATTGAGGG - Intergenic
918121890 1:181547496-181547518 CTGGAAAGAAGCTGGACTCAAGG - Intronic
918576429 1:186066493-186066515 GTGGAAAGATACAGGGTCGAGGG - Intronic
918626291 1:186659355-186659377 GTGGAAAGAAAGATGATTGATGG - Intergenic
920089146 1:203440127-203440149 GTGGGAAGAGGCAGTAATGAAGG + Intergenic
920484108 1:206352565-206352587 GTGGAGAGAAGGAGGGTTCATGG - Intronic
920577470 1:207072089-207072111 GTGCAGAGGAGCAGGAGTGAGGG + Intronic
920749682 1:208661902-208661924 GTGAAAAGAGGCAGGATTCTAGG - Intergenic
921409151 1:214815840-214815862 GTGAAAAGAAGCAAGAGTGAGGG - Intergenic
921686546 1:218095457-218095479 GTGGAAGGAAGAGGGACTGAAGG + Intergenic
922368244 1:224885995-224886017 GTTGAAAGAAGAGAGATTGAAGG - Intergenic
922546112 1:226458088-226458110 ATGGACAGAAGAAGGACTGAAGG + Intergenic
922745577 1:228041591-228041613 GTGGATAGATGATGGATTGAGGG - Intronic
1063282330 10:4644081-4644103 CTGAAAAGAAGCAGGTTTGATGG - Intergenic
1064350629 10:14573141-14573163 GTGGAGAGAAACAGGCTTGGTGG + Intronic
1064733407 10:18356372-18356394 GTGGAAAGAAGTTGGCTTGCTGG - Intronic
1065964411 10:30759378-30759400 CTGGAAATAAGCAGCAATGAGGG - Intergenic
1067404048 10:46004254-46004276 ATGGAATGAAGCAGGATTGTTGG - Intergenic
1068105985 10:52616962-52616984 ATATAAAGAAGCAGGATAGAGGG + Intergenic
1068558240 10:58482140-58482162 GTGGAAAGAAGGAGGGAGGAAGG - Intergenic
1069604145 10:69729326-69729348 GTGGAAATAGGCAGAATTGAAGG + Intergenic
1069688497 10:70334589-70334611 GTGGACAGCAGCAGCTTTGATGG + Intronic
1071101986 10:82049445-82049467 ATGTAAAGAAGTAGGATTTAAGG - Intronic
1071307007 10:84308322-84308344 GTTGAAGCAAGCAGGCTTGAGGG - Intergenic
1071479428 10:86053752-86053774 GGGGAAAGATGCAGGATTTGAGG + Intronic
1071768700 10:88700047-88700069 GTGTAAAGATGCAGGATTGATGG + Intergenic
1072531032 10:96319534-96319556 ATAGAAAGAAGAAGGATAGAAGG - Intronic
1074666890 10:115737761-115737783 TTAGAAAGAAGCAGAATTGGGGG - Intronic
1075341406 10:121649333-121649355 GAGGACGGAAGCAGGATGGAAGG + Intergenic
1076235466 10:128860864-128860886 GTGGCAGGAAGCAGGAATGCAGG - Intergenic
1076456569 10:130604060-130604082 GTGGAAACAAGCACGAGTTACGG + Intergenic
1077231979 11:1461821-1461843 GTAGAAAGAAGCAGGAGCAAGGG - Intronic
1078753878 11:14190522-14190544 GAGGAAGGAAGAAGGATGGAAGG - Intronic
1078768592 11:14324941-14324963 GTGGAAAAAAGCGAGATTGAGGG + Intronic
1080689260 11:34542318-34542340 GTGGAGAGAAGCAGCAGTCAGGG - Intergenic
1081160837 11:39745966-39745988 TTGGAAAGAAACAGTGTTGAAGG - Intergenic
1082628371 11:55511822-55511844 GAAGAAAGAAGCAGGAAGGAAGG - Intergenic
1083402181 11:62431134-62431156 GTGGGAAGCAGCAGGATTTGAGG - Intergenic
1084551407 11:69845227-69845249 GGGGAAGGAAGCTGGAGTGAAGG - Intergenic
1085738872 11:79062865-79062887 GTGGGGAGAAGCAGGGTTGCTGG + Intronic
1086763808 11:90669174-90669196 CAGGCAAGAAGCAGGATTCAGGG - Intergenic
1087392867 11:97560753-97560775 GTGGAAAGACACAGGGTGGAGGG - Intergenic
1087682984 11:101235762-101235784 GAGAAAAGTGGCAGGATTGAGGG + Intergenic
1088238218 11:107747830-107747852 GTGAAAAGAAGCAGCTTTCATGG - Intergenic
1088432055 11:109769291-109769313 CTGGAAAGGAGCAGCACTGAGGG - Intergenic
1088767578 11:112998586-112998608 GTGAACACAAGCAGGATAGATGG - Intronic
1089422071 11:118339417-118339439 GGGGAAGGAGGCAGGAATGAAGG - Intronic
1089637970 11:119828547-119828569 GTGGAGACATTCAGGATTGAGGG + Intergenic
1090085427 11:123646093-123646115 GTGGAATGAAGGGGGATGGATGG - Intronic
1090484408 11:127099684-127099706 GTGTCCAGAAGAAGGATTGATGG - Intergenic
1090529415 11:127575216-127575238 GAGGAAGAAAGCAGCATTGAAGG - Intergenic
1090678830 11:129031448-129031470 GTGAAAAGCAGCAGGGTTAAAGG - Intronic
1091893734 12:4083653-4083675 GTGAAAAGGAGCAGAATGGATGG - Intergenic
1091907721 12:4202184-4202206 GTGAAATGAAGCGGGGTTGATGG + Intergenic
1091978684 12:4848232-4848254 GTTGACAGAAGCAGGGTTGAGGG - Intronic
1092883374 12:12905218-12905240 AAGGAAAGAGGCAGGATTCAGGG + Intronic
1093082935 12:14834679-14834701 GCTGAAAGAAGCAAGATTTAAGG + Intronic
1093396207 12:18685762-18685784 GTGTAATGAAGTAGGATTGGAGG - Intronic
1093873949 12:24327346-24327368 GTGCACAGAAGCAGAAATGAAGG + Intergenic
1093881070 12:24405330-24405352 GGAGAAAGAAGCAAGATTCAAGG - Intergenic
1094466896 12:30763019-30763041 GGGGACAGAAGCAGGAGTGAGGG + Intergenic
1094774945 12:33714912-33714934 ATGGAAAAAAGCAAGTTTGAAGG - Intergenic
1095762461 12:45855000-45855022 GTGGAAAGAAGAAAGGTTAATGG - Intronic
1095916138 12:47480959-47480981 GTGGAAAGAAGGAGGACAGCAGG + Intergenic
1096539075 12:52293913-52293935 GAGAACAGAAGCAGGATTGATGG + Intronic
1096571081 12:52523727-52523749 GAGGGAAGAAGAAGGATGGAGGG - Intergenic
1097442499 12:59628048-59628070 GTGGAAAGATGTTGGATTCAAGG - Intronic
1097794453 12:63846653-63846675 GTGGAAGGAAGAAGTGTTGAAGG - Intronic
1098149566 12:67532405-67532427 GGGGAAAGATGCAAGAGTGAAGG - Intergenic
1098457530 12:70691842-70691864 TTGGAAAAAAGCAAGATTGAAGG - Intronic
1098486736 12:71030220-71030242 GTGAAAAGAAGCCGCCTTGAAGG + Intergenic
1098622732 12:72623713-72623735 GTGGATAGGGGCAGGACTGAAGG + Intronic
1100373947 12:93994919-93994941 CTGGAAAGATGCAGGAGAGAGGG - Intergenic
1101430168 12:104620099-104620121 TTGGAAATTAGCAGGCTTGAAGG + Intronic
1101822846 12:108197246-108197268 ATGGAAGGAAGCAGGATTAATGG + Intronic
1104301727 12:127570607-127570629 GAGGAAAGAAGGAGGAAGGAAGG + Intergenic
1104616417 12:130273573-130273595 GAGGAAAGAAGGAGGAAAGAAGG - Intergenic
1106084925 13:26533147-26533169 AGGGAAAGAACCAGGTTTGAGGG - Intergenic
1106234520 13:27850858-27850880 CTGGAAGGAAACGGGATTGAGGG - Intergenic
1106876542 13:34080237-34080259 GTGGAAATGAGCAGCATAGAAGG + Intergenic
1107146516 13:37066439-37066461 GTGGAAAGCAGCTGGAGAGAGGG - Intergenic
1107381471 13:39861232-39861254 CTGGAAAGAAACAGTTTTGAGGG + Intergenic
1107683992 13:42878575-42878597 GTGGAAAGAGGAAGGAAGGAAGG + Intergenic
1108168622 13:47718556-47718578 GGGGAAGAAAGCAGGATTGCAGG + Intergenic
1110119910 13:71867133-71867155 GTGAAAAGGAGGAGGTTTGAAGG + Intronic
1110964037 13:81668746-81668768 GAGGAAGGAAGAAGGATGGAAGG - Intergenic
1112027014 13:95420411-95420433 GTGGAAAGAAGGAGGGATGGAGG + Intergenic
1113152444 13:107279719-107279741 TTGCAAAAAAGCAAGATTGAGGG - Intronic
1113411030 13:110090016-110090038 GTGGAAAGAAGTAGTACTGCAGG + Intergenic
1113742508 13:112721334-112721356 CGGGAAAGAAGCAGGAAGGAAGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1113997418 14:16099780-16099802 GTGGAATGGAGTGGGATTGAAGG - Intergenic
1114316378 14:21513382-21513404 TTGGAAAGAAGCTGGAATCAAGG + Intergenic
1114919444 14:27308147-27308169 GAGGTGAGGAGCAGGATTGAGGG - Intergenic
1115396482 14:32914812-32914834 GAGGAAAGAAGCAGCCTTCATGG - Intergenic
1116377412 14:44221199-44221221 GTAGAAAGAAGAAGGAAGGAAGG + Intergenic
1118507452 14:66428992-66429014 GTGGAGAGAAGCAGGAAAAAGGG + Intergenic
1119352088 14:73974264-73974286 GTGGAAAGTTGCTGTATTGAAGG - Intronic
1120520123 14:85517596-85517618 AGGGAAATAAGGAGGATTGAGGG - Intergenic
1120937404 14:89910786-89910808 GTGGGAAGAAGCAGGAAGAATGG + Intronic
1121078564 14:91089336-91089358 GCAGAAAGAAGCAGGAGAGACGG + Intronic
1121154114 14:91666816-91666838 GAGAAAAGTAGCAGGGTTGAGGG - Intronic
1121502593 14:94450044-94450066 GAGCAAAGTAGCAGGACTGATGG + Intronic
1121762021 14:96453956-96453978 GTGGAAGGAGGCAGGTGTGAAGG - Intronic
1121981194 14:98455976-98455998 GTGAAAAGAAGCAGGACTTCTGG + Intergenic
1122032355 14:98921680-98921702 GTGGAAAGAAGTAGGATTGCTGG + Intergenic
1123020517 14:105395834-105395856 CTGGGGAGAAGCAGGACTGAGGG - Exonic
1123151714 14:106187660-106187682 GAAGAAATAAACAGGATTGAGGG - Intergenic
1123185654 14:106514231-106514253 GAGGAGAGAAACAGGATTGGGGG - Intergenic
1123400110 15:19975540-19975562 GAAGAAAGAAACAGGATTGAGGG - Intergenic
1123670519 15:22652112-22652134 GAAGAAGGAAGCTGGATTGAGGG + Intergenic
1123982780 15:25619251-25619273 GTGGAGAGAAGCAGGAGAGACGG - Intergenic
1124526501 15:30458549-30458571 GAAGAAGGAAGCTGGATTGAGGG + Intergenic
1124772153 15:32549134-32549156 GAAGAAGGAAGCTGGATTGAGGG - Intergenic
1125444516 15:39738901-39738923 GGGGAAAGCATCAGGCTTGAAGG + Intronic
1126110860 15:45173942-45173964 GTGGCAAGCAGCAGGATGCAGGG + Intronic
1126486588 15:49187970-49187992 GAGGAAAGAAGGAAGATTAACGG - Intronic
1131515620 15:93074366-93074388 GTGGAGAGGAGCAAGTTTGAAGG + Intronic
1131664015 15:94550459-94550481 GTGCAGAGAAGCAGAAATGAAGG - Intergenic
1133431553 16:5741293-5741315 TTGGAAAGTGACAGGATTGATGG - Intergenic
1133596181 16:7295357-7295379 TTGCAAAGAAGGAGGAATGATGG + Intronic
1135067184 16:19320241-19320263 GCGGAAAGAAGGTGGCTTGAAGG + Intronic
1135383906 16:22019231-22019253 GGGGAAAAAAGCAGGATCTAAGG - Intronic
1135399031 16:22152905-22152927 TGGGAAAGAAGCAGGATTTGAGG + Intronic
1136845681 16:33573907-33573929 TTGGAAAGCAGCAGGAATGATGG + Intergenic
1137548693 16:49421905-49421927 GTGGAAAGATGGAGGCTTGGAGG + Intergenic
1138155174 16:54696298-54696320 GTGGAAGGATGCAGGATGGAAGG + Intergenic
1138482781 16:57315026-57315048 GGGGAAGGAAGCAGGAGTCAGGG - Intergenic
1138789860 16:59890704-59890726 GTGGAAAAGAGCAGGCTTGCTGG + Intergenic
1139021259 16:62752937-62752959 ATGGAAAGCAGGAGAATTGACGG - Intergenic
1140853253 16:78954305-78954327 GTGGATAGAAGGTGGATGGATGG + Intronic
1141421623 16:83921405-83921427 ATGGAAGGAAGGAGGATGGATGG + Exonic
1141526576 16:84615547-84615569 GAGGAAAGAAGCTGAATTTAGGG + Intronic
1203107389 16_KI270728v1_random:1422560-1422582 TTGGAAAGCAGCAGGAATGATGG + Intergenic
1143021318 17:3918303-3918325 GAGGAAAGAAGAAGGAGGGAGGG + Intergenic
1143305943 17:5946801-5946823 GTGGAGAGGAGAAGGATGGAGGG + Intronic
1143771438 17:9171554-9171576 GAGGAAAGCAGCAGGGTGGAAGG + Intronic
1143841105 17:9732367-9732389 GTGGAAAAGAGCAGGAGTGGAGG - Intergenic
1144085798 17:11807467-11807489 ATGGAAGGGAGCAGGATTGCAGG - Intronic
1144967526 17:19087440-19087462 GTGGAAAGCAGCAGGGAAGAGGG - Intergenic
1144980393 17:19164625-19164647 GTGGAAAGCAGCAGGGAAGAGGG + Intergenic
1144987829 17:19213607-19213629 GTGGAAAGCAGCAGGGAAGAGGG - Intergenic
1145804455 17:27716604-27716626 GAGTAAAGTAGCAGGGTTGAGGG - Intergenic
1146551185 17:33781690-33781712 GGGGAAAGGAGCAGTATTCAAGG - Intronic
1147042853 17:37731538-37731560 GTGGCAAGAACCAGGATGGTTGG + Intronic
1147893519 17:43734369-43734391 CTGGAAAGAAGCAAGCTGGAGGG - Intergenic
1149016128 17:51910419-51910441 GTGGAATGAGGCAGGGTAGAAGG - Intronic
1149074251 17:52578056-52578078 GAGAAAAGTAGCAGGGTTGAGGG - Intergenic
1150667249 17:67152792-67152814 GTGGAAGGAAGAATGACTGATGG + Intronic
1153369186 18:4294813-4294835 GTGGAACTCAGCAGGATAGATGG + Intronic
1153863780 18:9242702-9242724 GTAGAAAGACGTATGATTGAGGG + Intronic
1153912007 18:9712636-9712658 GTGGCAAGAAGCAGGAGGAAGGG + Intronic
1155475761 18:26234754-26234776 GAGAAAAGTAGCAGGGTTGAGGG + Intronic
1155662562 18:28268067-28268089 GAGGAAAGAAGCAGGGAAGAAGG - Intergenic
1155841529 18:30650499-30650521 GAGGAAAGAAGCAGAATCAATGG + Intergenic
1156070463 18:33201204-33201226 AGGGAAAGAGACAGGATTGAGGG - Intronic
1157125725 18:44953986-44954008 GTGGAAGGAGGCAGGCTGGAAGG + Intronic
1158057234 18:53296188-53296210 GTGGAAAACAGCAGGAAGGAAGG - Intronic
1158191498 18:54833525-54833547 GTAGAAAGAAGAGGGATTCATGG - Intronic
1159883788 18:73885086-73885108 GAGGGAAGGTGCAGGATTGAGGG + Intergenic
1160122419 18:76142666-76142688 GTGGAATCCAGCAGGAATGAAGG + Intergenic
1161597861 19:5161026-5161048 GAGAAAAGTGGCAGGATTGAGGG + Intronic
1161715053 19:5871225-5871247 TTGGAAAGATGCTGGAGTGATGG + Intronic
1163435529 19:17292945-17292967 GTGGAGAGATGCAGGGTAGATGG - Intronic
1164409667 19:27990403-27990425 GTGGATAGAAATAGGGTTGATGG - Intergenic
1164441816 19:28284869-28284891 GTGGAGAGAAGGAGGGTGGAGGG + Intergenic
1165412414 19:35670286-35670308 TGGGAAAGAAGCAGGAGGGAAGG + Intronic
1168508272 19:56954604-56954626 GTGGATAGATGGAGGATGGATGG - Intergenic
926480246 2:13383687-13383709 GTGGAGAGAAGCGTGATTGATGG + Intergenic
926665873 2:15522402-15522424 ATGAGAAGAAGCAGGTTTGAAGG + Intronic
926681262 2:15665700-15665722 GTGGAAAGACACAGGACTGTTGG + Intergenic
927405079 2:22757592-22757614 GTGGAAGGGAGCAGGAAGGAAGG - Intergenic
927484057 2:23476991-23477013 CTGGAATGAAGCAGGCTGGAGGG + Intronic
927621025 2:24658929-24658951 GAGGAAGCAAGCTGGATTGAGGG - Intronic
927840540 2:26439350-26439372 GTGATAAGAAGCAAGATAGAGGG - Intronic
930548577 2:52801699-52801721 ATGGAAAGAAGAAGGAATGGAGG + Intergenic
931947431 2:67325544-67325566 GTGGACAGAGGCAGGAAAGAAGG + Intergenic
932655524 2:73608220-73608242 GTGGAAAGAAGTGGGATAAAGGG - Intronic
932896121 2:75641811-75641833 GTGGCAAGAAGCAGCCTTGCTGG + Intergenic
933050156 2:77592360-77592382 GTGCAAAGTTGCAGGATGGATGG + Intronic
935972808 2:108547012-108547034 GAGGTAAGAAGAAGGGTTGATGG + Intronic
936802415 2:116284872-116284894 GAGAAAAGTAGCAGGGTTGAGGG - Intergenic
937059183 2:118968989-118969011 GTGGCAAGAAAGAGGATTGGGGG + Intronic
937138136 2:119573114-119573136 GTGCTAAGAAGGAAGATTGATGG + Intronic
937175978 2:119935671-119935693 TTGGCAAGAAATAGGATTGATGG + Intronic
938796392 2:134721019-134721041 GAGGATAGAACCAGGATTAATGG - Intergenic
939602959 2:144216629-144216651 GTTGACAGAAGCAGAATTTATGG + Intronic
943631161 2:190253957-190253979 CTGGAAAGAAGCAGAATTGGGGG - Intronic
944936296 2:204572385-204572407 GAGGAAAGAACCAGGCTGGAGGG + Intronic
945930196 2:215847178-215847200 CTGGAAGGAAGAAGGGTTGAAGG + Intergenic
946565159 2:220956439-220956461 GAGAGAAGAAGAAGGATTGATGG - Intergenic
946665788 2:222048569-222048591 GTGGAAATAAATTGGATTGAGGG + Intergenic
946928265 2:224647301-224647323 TAGAAAAGAAGCAAGATTGAGGG + Intergenic
946972918 2:225115646-225115668 GTGGATTGAACCAGGAGTGAGGG - Intergenic
946973673 2:225123293-225123315 AAGGAAAGAAGAAGGATGGAAGG - Intergenic
1168876197 20:1173925-1173947 GTGGACAGCGGCAGGATTAAAGG - Intronic
1168943441 20:1732266-1732288 GGGGAAAGAAGGAGGATTTGGGG + Intergenic
1169192752 20:3668452-3668474 GTGGGAAGAAACAGGAAGGAAGG + Exonic
1169975957 20:11328236-11328258 GTGGAAAGATGAAGGAGGGAGGG + Intergenic
1170587108 20:17743046-17743068 GTGGGTACAAGGAGGATTGAAGG - Intergenic
1172714393 20:36951904-36951926 GTGGCTAGAAGCAGAACTGAGGG + Intergenic
1172939504 20:38644735-38644757 GTGGAGAGATGCATGATTGGTGG - Intronic
1173054477 20:39597792-39597814 GGGGCAAGAAGCAGGATGCATGG - Intergenic
1173144214 20:40510858-40510880 GAGGAAAGAAGGAGGAAGGAAGG + Intergenic
1174701137 20:52610829-52610851 GTGGAAGGAAGAAGGAAGGAAGG - Intergenic
1174701146 20:52610865-52610887 GTGGAAGGAAGAAGGAAGGAAGG - Intergenic
1174809842 20:53636291-53636313 GAGGAAAGAAGAAGGAAGGAAGG + Intergenic
1175187612 20:57189555-57189577 GTGATATGAAACAGGATTGACGG - Intronic
1175564354 20:59961180-59961202 GTGGGTAGGAGCAGGAGTGAGGG - Intronic
1176226272 20:64001458-64001480 CTGGAAAAAGGCAGGAGTGAGGG - Intronic
1177055144 21:16292503-16292525 TTGGAAAGGAGCAGGATTTCAGG - Intergenic
1177580372 21:23014805-23014827 GTGGAAAGATAAAGGATTCAAGG - Intergenic
1178293817 21:31391761-31391783 GTGGAAGGAAGCAGGCCTGCGGG - Intronic
1178888666 21:36502024-36502046 GTTGGAAGAGGCAGGATGGAAGG + Intronic
1179905202 21:44419007-44419029 TTGGAAAGAAGCAAGATGGGAGG - Intronic
1180713522 22:17856216-17856238 GGGGAAAACAGCAGGAGTGACGG + Intronic
1181284449 22:21741704-21741726 TTGGGAAGAGGCAGGACTGAGGG + Intergenic
1181537226 22:23552733-23552755 GAGGAAAGATGAAGGATAGATGG - Intergenic
1181942516 22:26489435-26489457 TGGGACAGAACCAGGATTGAAGG + Intronic
1181986049 22:26800516-26800538 GGGGAAAGAAGGAGGAGTGGAGG + Intergenic
1182051803 22:27317960-27317982 GTGGAAAGCAGGAGGGTGGAGGG - Intergenic
1184695984 22:46139406-46139428 TTGGAAAGCAGCAGGAATGATGG - Intergenic
949312203 3:2712753-2712775 GGGGAAAGAAGAGGGACTGAAGG + Intronic
950128608 3:10526714-10526736 GTGGAAAGAATAGGGACTGAGGG + Intronic
950492441 3:13314269-13314291 GTGGAGAGGAGCAGGGTTCAGGG - Intergenic
951393093 3:22130728-22130750 AAGGAAAGAAGCAGGAAAGATGG - Intronic
951657190 3:25022792-25022814 GTGGCAAGAAGCAGCATGGTGGG + Intergenic
951984075 3:28598450-28598472 CTGGAAAGGAGCAGGATTTGGGG + Intergenic
952057847 3:29472016-29472038 GTGGAAAGTAGTAGCATTGATGG - Intronic
952638507 3:35561817-35561839 GTGTAAAGAAGCACAACTGATGG - Intergenic
952940602 3:38441545-38441567 GAGAAAAGTAGCAGGGTTGAGGG + Intergenic
953016350 3:39080572-39080594 GTGCAAAGAACCATGCTTGAGGG + Intronic
954660777 3:52225766-52225788 GTGGAAAGAGGAAGGGGTGAAGG - Exonic
954996743 3:54888713-54888735 ATGGAGAGAAACAGGATAGAAGG - Intronic
955342483 3:58135863-58135885 GTGGAAACAGACAGAATTGATGG - Intronic
955661908 3:61308547-61308569 TTGGAAAGAATCATGATTAATGG + Intergenic
955707900 3:61747332-61747354 ATGGAAAGAGGAAGGATTAATGG + Intronic
956021548 3:64938513-64938535 ATGGCCAGAGGCAGGATTGATGG - Intergenic
956769638 3:72513874-72513896 GGGGAAAGAAGTGGTATTGAGGG - Intergenic
958546303 3:95555933-95555955 GAGGAGGGAAGCAGAATTGAAGG + Intergenic
960279276 3:115763066-115763088 GTGAAAAGAAATAGTATTGAGGG - Intergenic
960308742 3:116094522-116094544 GTGCAAAGAAGCAAGGGTGAGGG - Intronic
962261642 3:133912959-133912981 GTGGATAGAAGGATGATCGATGG + Intergenic
962933871 3:140061502-140061524 CTGGAAAGAAGCAGGGCTGGTGG - Intronic
963674135 3:148287100-148287122 GTGGAAAGAGACAGGATTAAAGG - Intergenic
964175425 3:153821940-153821962 AAGGAAAGAATCAGGAGTGAAGG + Intergenic
964724387 3:159799289-159799311 GTGAAAAGAAGCAGACTTCAGGG + Intronic
965404020 3:168248943-168248965 GGGGAAAGGAGCTGGTTTGAAGG + Intergenic
965412289 3:168347062-168347084 GTGGAAAGAGGCAAGAGTGTAGG + Intergenic
966950429 3:184812252-184812274 GTGGAAGGAGACAGGATTGAGGG + Intronic
967394258 3:188989721-188989743 GTGGAAAGAGGCTGGAATGAAGG - Intronic
968598688 4:1498811-1498833 GAGAAAAGGAGCAGGATTGCTGG - Intergenic
969660643 4:8525495-8525517 GCGTAGAGAAGCAGGATTGGAGG + Intergenic
971176740 4:24289412-24289434 GTTGGAGGAGGCAGGATTGATGG - Intergenic
971246630 4:24935039-24935061 GAGGAAAGAAGGAGGATAGGTGG + Intronic
972207569 4:36795806-36795828 GGGGAAAGAGGCAGGAGTGTCGG - Intergenic
973301565 4:48590927-48590949 GTGGAAGGAAGGAAGATAGAAGG + Intronic
973757183 4:54086884-54086906 TTGGAAAGAAGAAAGATTGTTGG + Intronic
973838288 4:54833837-54833859 ATGGAAAGAAGCATATTTGAAGG + Intergenic
973925573 4:55734183-55734205 CTGGAAAGAAACAGGTTTTATGG + Intergenic
974005809 4:56556111-56556133 ATGGAAAGAAGCAGGCTTTGTGG - Intronic
975367055 4:73541680-73541702 GTGGAGAGATGGATGATTGATGG - Intergenic
976187297 4:82454755-82454777 GTGGAGAGAGGCCGGAATGAAGG + Exonic
976470611 4:85424534-85424556 GTAGATAGAAGTAGGATTGCTGG + Intergenic
977684631 4:99834532-99834554 GTGAAACGAAGCTGGATGGAAGG - Intronic
978260309 4:106748678-106748700 GTGGAAAGAAACGGGTGTGAGGG + Intergenic
978302294 4:107284281-107284303 GTGGCAAGAAGCAGGATAATAGG - Intergenic
978623397 4:110657045-110657067 GTGGAAAGAATCTTGTTTGAGGG + Intergenic
979454637 4:120913617-120913639 GAGGAAAGTAACAGGTTTGAGGG - Intronic
980670008 4:135993430-135993452 ATGGAAAGAAGAAGGAAGGAAGG - Intergenic
980888955 4:138793644-138793666 GAGGAAAGAAGAAGGAAGGAAGG + Intergenic
981977357 4:150746898-150746920 ATGGAAAGAAGTTGGATTGGAGG - Intronic
982884904 4:160766367-160766389 GAGGAAAGAAGAAGGAAGGAAGG + Intergenic
983783937 4:171708124-171708146 GTGGATAGATGAAGGATGGATGG - Intergenic
983809214 4:172037587-172037609 GTGGAATGAGGCAGCATTCAGGG - Intronic
984396593 4:179209697-179209719 TTTGAAAGAATCAGGATTTAGGG - Intergenic
984917802 4:184739339-184739361 GAGAAAAGTAGCAGGGTTGAGGG - Intergenic
985167742 4:187115461-187115483 GGAGAAGGAAGTAGGATTGAAGG + Intergenic
987046227 5:14111588-14111610 GTGGAAAGAAGCATTACAGATGG - Intergenic
987121608 5:14773070-14773092 GTGGGAGGAAGCAGGATAGGTGG - Intronic
987204093 5:15607229-15607251 GTGGAGAGAAGCAGGAAATAAGG + Intronic
987462456 5:18228991-18229013 CTGGAAAGAAGAAGGAATAAAGG + Intergenic
989520975 5:42399556-42399578 GTGGAAAGATGCTGGAAGGAGGG + Intergenic
989843898 5:46115359-46115381 TTGGAAAGAAGCAGACTTAAGGG - Intergenic
990203045 5:53399184-53399206 GTGGTCAGAAGGAGAATTGAGGG + Intergenic
990397793 5:55401499-55401521 GTGGAATTAGGTAGGATTGATGG + Intronic
991460725 5:66855562-66855584 TTGTCAAGAAGCAGGAATGAGGG + Intronic
992092336 5:73328367-73328389 GTGGAAGAAAGCAGGATCCAGGG - Intergenic
992213815 5:74506506-74506528 GTGGAAAGAAGAAGGCTTTGGGG - Intergenic
992369163 5:76125346-76125368 ATTGAAAGAAGCAGGATAAAAGG - Intronic
994059566 5:95459351-95459373 GTGGAAAGAAGGAGGAGTTTAGG - Intergenic
994331610 5:98512890-98512912 GTGGAAAGAAGCAGTAGGAAAGG - Intergenic
994727792 5:103456707-103456729 GTGGATGGAAGGAGGAGTGATGG - Intergenic
994909015 5:105877679-105877701 GGGGAAAGAAGCTTGATTTAGGG - Intergenic
995845642 5:116490996-116491018 GTGGAAAGAAGGAGTAGTGTTGG + Intronic
996871853 5:128201185-128201207 GAGGAAGGAAGCAGGAAGGAAGG - Intergenic
997528308 5:134567409-134567431 GTGAAATGAAGCAGGATTTCTGG + Intronic
997715902 5:136042601-136042623 TTAGAAAGAAACAGGATGGAAGG + Intronic
998147786 5:139740109-139740131 GTGGTAAGGTGGAGGATTGAGGG + Intergenic
998392671 5:141797421-141797443 GTGAGAAGAAGCAGGAGGGAGGG - Intergenic
999037887 5:148373945-148373967 GTGGGGAGAAGCAGGATGGTTGG - Intergenic
999618354 5:153449510-153449532 GTGGAGAGAGGCAGGTTAGAAGG + Intergenic
1000034240 5:157431122-157431144 ATGAAGAGAAGCAGGATTTAAGG + Intronic
1000266717 5:159645092-159645114 GTGGAAAGCAGCAGGGGTGGGGG + Intergenic
1001277343 5:170360275-170360297 GTGGAAGGAAGCAGGATGCAGGG + Intronic
1001852783 5:174984123-174984145 TTGTAAAGAAGCAGCATTGTAGG - Intergenic
1002078766 5:176725634-176725656 GTGGCGGGAAGCAGGATTTAAGG - Intergenic
1003009833 6:2416349-2416371 GAGGAAAGAAGAAGGAAGGAAGG - Intergenic
1003135725 6:3433436-3433458 GGGGTAGGAAGCAGGAGTGATGG - Intronic
1003360982 6:5424994-5425016 GTGGAAAGAAAAAGGAAGGAGGG - Intronic
1003778905 6:9400474-9400496 GTTGAAAGAAGCAAGGTTGCAGG - Intergenic
1003803375 6:9697263-9697285 GTTGGAAGAAGCAGGTTGGAAGG + Intronic
1003941071 6:11027578-11027600 GAGGAAAGAATTAGGATTTATGG - Intronic
1004015426 6:11727904-11727926 GGGGAAAGAAGAAGGAAGGAAGG + Intronic
1004531712 6:16460596-16460618 GAGAAAAGTAGCAGGGTTGAGGG - Intronic
1005417867 6:25620838-25620860 TTGGAAAGAAGAATGATAGAAGG + Intergenic
1006000550 6:30961730-30961752 GTATAAGGATGCAGGATTGATGG - Intergenic
1007030371 6:38621302-38621324 GAGAAAAGTAGCAGGGTTGAGGG - Intronic
1007037428 6:38689141-38689163 GTGGAAAGAAACTGAATTCAGGG + Intronic
1007383188 6:41503731-41503753 GTGGAATGAAGCTGGGTGGAGGG + Intergenic
1007741006 6:44009517-44009539 ATGGAAAGAAGAAGGAAAGAGGG + Intergenic
1007775622 6:44223062-44223084 GGGGACAGAAGCAGTTTTGAAGG + Intronic
1008206661 6:48668333-48668355 GTGGAAAGTTGCAGAATTAAAGG - Intergenic
1008512678 6:52291493-52291515 TTGGATAGAAGCAGGAGTGAGGG + Intergenic
1010189057 6:73175972-73175994 TTGCAAAGAAGCAGAAGTGAAGG + Intronic
1011716409 6:90109663-90109685 CTGGAAAGAAGCAGGTTTGGAGG - Intronic
1011968909 6:93196893-93196915 ATGCAAAGAAACAGGATTGCAGG + Intergenic
1012408825 6:98932575-98932597 GCGGAGAGAAGCAGGATGGCAGG + Intronic
1012938277 6:105390903-105390925 GTGTAAAAAAGCAGGGCTGAAGG + Intronic
1012982883 6:105848395-105848417 GTGGAAGTAAGCAGGGTGGATGG - Intergenic
1013403208 6:109818785-109818807 ATGGAAAGCAGCAGGATGCAGGG - Intronic
1013415921 6:109924428-109924450 GTGGAAAGAGACAGGCTGGATGG + Intergenic
1015991118 6:138944498-138944520 CTGGACAGAAGCAGGATGCATGG + Exonic
1017979628 6:159388896-159388918 GTGAAAACAAACAGAATTGAGGG - Intergenic
1019146804 6:169980891-169980913 GCGGAAAGGAGCAGGGTGGATGG + Intergenic
1019345601 7:528744-528766 ATGGATAGAAGATGGATTGATGG + Intergenic
1019549263 7:1594066-1594088 ATGGAAAGAGGGAGGATAGATGG - Intergenic
1020131056 7:5558871-5558893 GCCCAAAGAAGCAGGAATGAGGG + Intronic
1021129460 7:16893908-16893930 GTGGAAAGGGGCAGGATATATGG - Intergenic
1021342792 7:19485806-19485828 TTGGAAAGAAACAGGAATAAAGG + Intergenic
1022165325 7:27754306-27754328 GTGGAATGAGACAGGACTGAAGG - Intronic
1022335515 7:29418057-29418079 GTGGAGAGATGAAGGATTGCTGG + Intronic
1022451583 7:30520815-30520837 GTGGAGAGAGGCAGGAAGGAAGG + Intronic
1022976989 7:35567728-35567750 GTGGGAAGAAGCAGGAATAGGGG + Intergenic
1023342279 7:39233996-39234018 GTTAAAACAAGCAGGATAGAAGG - Intronic
1024153590 7:46597983-46598005 GTAGAAAAAAGCTGGCTTGATGG - Intergenic
1024559465 7:50631132-50631154 GTGGCAGGAAGCAAGAGTGAGGG - Intronic
1024692559 7:51818876-51818898 GGGGAAAGAAGCAGGAAGCATGG + Intergenic
1025243269 7:57295808-57295830 CTGGGTAGAAGCAGGATTGCTGG + Intergenic
1026705954 7:72693184-72693206 AAGGAAAGAAGGAGGATTAATGG + Intronic
1026870811 7:73850286-73850308 GAGGAAAGAAGCTGGATTTTAGG - Intergenic
1028154633 7:87415908-87415930 GTGGAAAGAAGCAGGATTGAGGG + Intronic
1029697310 7:102222297-102222319 GTGAAATGACGCAGGAATGACGG + Intronic
1031346373 7:120671800-120671822 GTAGAATGACGCAGGTTTGAGGG - Intronic
1031863115 7:127006020-127006042 GTGGAAGGAGGGAGTATTGAGGG - Intronic
1032019392 7:128398632-128398654 GTGAAATGAAGCAGGCTTGGTGG + Intronic
1032793740 7:135261031-135261053 GCGGGAAGAAGCAAGATTGGAGG + Intergenic
1032866081 7:135925619-135925641 GTGGAAAGAAGGAGCTTAGAGGG - Intergenic
1033375787 7:140760584-140760606 GAAGAGAGAAGCAGGATTAAGGG + Intronic
1034426356 7:151016240-151016262 ATGGAAAGGAGGAGGAATGAGGG + Intronic
1035462338 7:159049739-159049761 GTGGCAAGCACCAGGATTCAGGG + Intronic
1035815489 8:2535153-2535175 GTGGAAAGGGACAGGATTCAAGG + Intergenic
1037412825 8:18616401-18616423 GTGGAGAGAATCTGTATTGATGG + Intronic
1037585076 8:20270547-20270569 GTAGAAAGAAGCAGGAAGGCTGG + Intronic
1038673678 8:29603527-29603549 GTAGACAGAGCCAGGATTGAGGG - Intergenic
1039354893 8:36804284-36804306 GTGGAAAGTGGCAGGATACAAGG - Intronic
1039852755 8:41384560-41384582 CTGGAATGAAGTAGGGTTGAGGG - Intergenic
1040372411 8:46789677-46789699 TAGGAAAGAGGCAGGATTCAGGG - Intergenic
1042216626 8:66434724-66434746 GGGGAAAGAATCAGCACTGAAGG + Intronic
1042726818 8:71888118-71888140 TTGGAAAGAGGAAGGTTTGAGGG - Intronic
1043112456 8:76203384-76203406 GTTGAATGAAGCATGATAGAAGG - Intergenic
1043245261 8:77991397-77991419 GTGGCAGGAAGCAGAAGTGAAGG + Intergenic
1045046433 8:98283595-98283617 TTCCAAAGAAGCAGGATTGCAGG + Intronic
1045971645 8:108085004-108085026 TTGGAAAGAAGTAGTATTTATGG - Intergenic
1048719383 8:137305477-137305499 TTGGAATGAAGAGGGATTGATGG + Intergenic
1048840012 8:138557449-138557471 GTGGACAGAAGCATGATTTGTGG + Intergenic
1051051165 9:12933021-12933043 GTGGATAGAGACAGGATTGGAGG - Intergenic
1052289834 9:26828266-26828288 GAGAAAAGTAGCAGGGTTGAGGG - Intergenic
1052349872 9:27447643-27447665 GTGCAAAGAAGCAGAAAGGAAGG - Intronic
1053054289 9:34985072-34985094 CTGGAGAGAAGCAGATTTGAAGG + Intergenic
1054744572 9:68841803-68841825 TTAGAAAGAAGAAGGATTGTAGG + Intronic
1055018569 9:71645197-71645219 AAGGAAAGAAGCAGGAAGGAAGG - Intergenic
1059770560 9:117420001-117420023 GTGGACAGGAAAAGGATTGATGG - Intergenic
1061645482 9:131997556-131997578 GTGGGAGGAAGCAGGACTGCTGG - Intronic
1203403396 Un_KI270519v1:137576-137598 GTGGAGTGGAGCAGGATGGAAGG + Intergenic
1185476570 X:419112-419134 GTGGCAATTAGCAGGATTTATGG - Intergenic
1186303675 X:8229951-8229973 GTAGAAAGCACCAGGAATGATGG - Intergenic
1186695176 X:12022858-12022880 GGGGAAAGAGGGAGGATTGGGGG - Intergenic
1187794113 X:22982609-22982631 GTAGAAGGAAACAGGATAGAAGG - Intergenic
1187891727 X:23942415-23942437 GGTGGTAGAAGCAGGATTGAAGG + Intergenic
1189770004 X:44416416-44416438 TTGGAAAGGAGCAGGATGAATGG - Intergenic
1190759199 X:53425690-53425712 TTTGAAAGAAGAAGGAGTGAGGG + Intronic
1191781179 X:64867466-64867488 GTTGATAGAAGCTGGATGGATGG - Intergenic
1194272216 X:91830261-91830283 GGAGAAGGAAGCAGCATTGATGG + Intronic
1195429363 X:104771089-104771111 GTAGAAAGAAGCAGGGATCATGG - Intronic
1195620141 X:106944730-106944752 GGGAAAAGGAGCAGGTTTGAAGG - Intronic
1196127040 X:112111894-112111916 GAGAAAAGTAGCAGGGTTGAGGG + Intergenic
1197188264 X:123613261-123613283 GTGGGAAGAAGAGGTATTGAGGG - Intronic
1197963062 X:132026510-132026532 GTGGAAAGAAACAGGTTTATTGG - Intergenic
1198175194 X:134148017-134148039 GAGAAAAGAATCAGGATTGCTGG - Intergenic
1199443313 X:147893771-147893793 ATGTACAGAAGCAGGATTGCTGG - Intergenic
1199751796 X:150826587-150826609 GTGGAAACAAGAAGAATTGGGGG + Intronic
1199825365 X:151493402-151493424 GTGGGAAGGAGAAGGAGTGAAGG - Intergenic
1200589462 Y:5051683-5051705 GGAGAAGGAAGCAGCATTGATGG + Intronic
1200931051 Y:8697502-8697524 ATGAAAAGAAGCAGCATTTATGG + Intergenic
1201430268 Y:13895678-13895700 GAGAAAAGTAGCAGGGTTGAGGG + Intergenic
1201431252 Y:13904744-13904766 CTAGAAAGCAGCAGGGTTGACGG - Intergenic
1201455423 Y:14163129-14163151 GAGAAAAGTAGCAGGGTTGAGGG - Intergenic
1201639953 Y:16167969-16167991 GAGAAAAGTGGCAGGATTGAGGG + Intergenic
1201662860 Y:16417356-16417378 GAGAAAAGTGGCAGGATTGAGGG - Intergenic
1201859765 Y:18584224-18584246 GTGGCAAGGAGCGGGATTGGGGG - Intronic
1201873556 Y:18736157-18736179 GTGGCAAGGAGCGGGATTGGGGG + Intronic