ID: 1028154635

View in Genome Browser
Species Human (GRCh38)
Location 7:87415913-87415935
Sequence AAGAAGCAGGATTGAGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028154630_1028154635 -7 Left 1028154630 7:87415897-87415919 CCATATGAAATGTGGAAAGAAGC 0: 1
1: 0
2: 1
3: 37
4: 389
Right 1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG No data
1028154626_1028154635 9 Left 1028154626 7:87415881-87415903 CCAACTGACCATTCTCCCATATG 0: 1
1: 0
2: 1
3: 12
4: 149
Right 1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG No data
1028154627_1028154635 1 Left 1028154627 7:87415889-87415911 CCATTCTCCCATATGAAATGTGG 0: 1
1: 0
2: 1
3: 21
4: 225
Right 1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG No data
1028154625_1028154635 13 Left 1028154625 7:87415877-87415899 CCATCCAACTGACCATTCTCCCA 0: 1
1: 0
2: 2
3: 34
4: 364
Right 1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG No data
1028154629_1028154635 -6 Left 1028154629 7:87415896-87415918 CCCATATGAAATGTGGAAAGAAG 0: 1
1: 0
2: 3
3: 36
4: 507
Right 1028154635 7:87415913-87415935 AAGAAGCAGGATTGAGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028154635 Original CRISPR AAGAAGCAGGATTGAGGGGC AGG Intronic
No off target data available for this crispr