ID: 1028155313

View in Genome Browser
Species Human (GRCh38)
Location 7:87422716-87422738
Sequence TGCTCAGGAAAGGCCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 332
Summary {0: 1, 1: 0, 2: 0, 3: 47, 4: 284}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028155313 Original CRISPR TGCTCAGGAAAGGCCCCTCT GGG (reversed) Intronic
900405924 1:2492982-2493004 TGCTCAGGGAAGGGTCCTCACGG - Intronic
902413184 1:16224141-16224163 TGATCAGGGAAGACCTCTCTAGG + Intergenic
902627991 1:17688028-17688050 TGCTAAGGAAAGGCCAAGCTGGG + Intronic
902722297 1:18311991-18312013 TGGTCAGGGAAGGCCTCTCTGGG - Intronic
903219569 1:21861659-21861681 TGCTCAGAAAAGTCTCTTCTAGG - Intronic
903367655 1:22815038-22815060 CTCTCAGGAAAGGCCTCTATGGG - Intronic
903540963 1:24096155-24096177 TGCTCAGGAAGGGCCTTTCCAGG - Intronic
905945553 1:41898512-41898534 GGCTCAGGCAAGGACCCTCAGGG + Intronic
907853845 1:58282186-58282208 TACTCAGGGAAGGCTTCTCTGGG - Intronic
908711659 1:67022498-67022520 TGATCAGGAAGGGCCCCACAAGG - Intronic
910032715 1:82749848-82749870 TGGCCAGGAAAGGCCTCTCTAGG - Intergenic
913508367 1:119540022-119540044 TGCACAGGGCAGGACCCTCTGGG - Intergenic
914847873 1:151292785-151292807 TTCTCAGACAAGGGCCCTCTAGG + Exonic
915179822 1:154048558-154048580 GGCCCAGGATAGGCCCCTCATGG - Intronic
915384325 1:155475804-155475826 TTCTCAGGAAAGACTTCTCTGGG + Intronic
916602335 1:166305312-166305334 TGGTCAGGTAAGGCCTCACTGGG + Intergenic
917918372 1:179727472-179727494 TGGTCAAGAAAGGCCACTCTAGG + Intergenic
919632983 1:199977053-199977075 TGGTCAGGGAAGGCCCCACCAGG - Intergenic
920252358 1:204630278-204630300 TACTGAGGAAAGGACCCTCAGGG + Intronic
920563344 1:206955088-206955110 TACTCAGGAAAGGGCACACTGGG - Intergenic
920849952 1:209622006-209622028 TGGTCAGGAAACACCTCTCTGGG + Intronic
922322636 1:224502078-224502100 TCCTCAGGGAAGACCCCTCTGGG - Intronic
922619225 1:226980182-226980204 AGCTCAGGAAAGGTCCTTCCAGG - Intronic
922746210 1:228045617-228045639 GGTTCAGCAAAGGCCCCTCCAGG + Intronic
923425620 1:233865958-233865980 TGGTCAGGGAAGGCCTCTCTGGG - Intergenic
924202292 1:241672751-241672773 TGGTCAGGGAAGTCCCCACTGGG + Intronic
1067535483 10:47106684-47106706 AGCTCAGCATAGCCCCCTCTGGG + Intergenic
1067691417 10:48504501-48504523 GGGTCAGGAAAAGCCACTCTGGG + Intronic
1068701846 10:60028744-60028766 TGCTCATAAAAGGCCCCAGTCGG - Exonic
1070280611 10:75045530-75045552 CGGTCAGGAAAGGCCACTGTGGG + Intronic
1070591998 10:77808003-77808025 TGGTCAGCACTGGCCCCTCTCGG - Intronic
1070601204 10:77867600-77867622 GGCTCAGGGCAGGCCCTTCTGGG - Intronic
1073593992 10:104782404-104782426 TGCTCAGGGAAGCCTGCTCTAGG - Intronic
1073613114 10:104964334-104964356 TGGTCAGGAAAGGCCTCATTGGG - Intronic
1073637464 10:105214512-105214534 TGCCCTGGAAAAGCCCCTCGGGG + Exonic
1074095868 10:110311961-110311983 TGCTCATGAAAGGCTCCTGGTGG + Intergenic
1074413508 10:113247553-113247575 TGGACAGCCAAGGCCCCTCTTGG + Intergenic
1074489967 10:113931202-113931224 TGATCAAGAAAAGCCACTCTGGG + Intergenic
1075203165 10:120423133-120423155 TGGTCAGGGAAGGCCTCTTTTGG + Intergenic
1075746933 10:124734603-124734625 TCCTCTGGAAAGGACGCTCTAGG + Intronic
1075797316 10:125129921-125129943 TGCACCGAAAAGGGCCCTCTGGG + Intronic
1076416377 10:130292742-130292764 GGCCCAGGACAGGCCCCTCATGG - Intergenic
1076947812 10:133664446-133664468 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076948802 10:133667756-133667778 GGCTCACGAAAGCCCCCTGTGGG - Exonic
1076949786 10:133671055-133671077 GGCTCACGAAAGCCCCCTGTGGG - Intronic
1076950770 10:133674354-133674376 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076951760 10:133677664-133677686 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076952749 10:133680974-133680996 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076953733 10:133684273-133684295 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076954717 10:133740625-133740647 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076955706 10:133743935-133743957 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076956696 10:133747245-133747267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076957683 10:133750554-133750576 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076958668 10:133753853-133753875 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076959657 10:133757163-133757185 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1076960641 10:133760462-133760484 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1078744666 11:14100253-14100275 AGTCCATGAAAGGCCCCTCTGGG + Intronic
1080578006 11:33617552-33617574 TGATCAGGGAAGGCCTCTCTGGG - Intronic
1080696333 11:34606073-34606095 TCATCAGGAAAGGCCCCCCCAGG + Intergenic
1081598248 11:44474022-44474044 TTCTCAGGCAAGCTCCCTCTAGG - Intergenic
1082098738 11:48153591-48153613 TTCTCAGGAAAGGACCTTCAGGG - Intronic
1083690608 11:64406284-64406306 TGGGCAGGAGAGGCCCCTCTGGG + Intergenic
1084475295 11:69385394-69385416 TCTTCAGGAAAGCCCCCACTGGG - Intergenic
1085416858 11:76324297-76324319 TGGTGGGGAAGGGCCCCTCTAGG + Intergenic
1085723903 11:78937325-78937347 TGTTCAGAAAAGCACCCTCTGGG - Intronic
1085842435 11:80028074-80028096 TGCTCAGGGGTGGCCTCTCTGGG - Intergenic
1087092021 11:94283472-94283494 TGGTCAAGAAAGGACTCTCTGGG - Intergenic
1089975808 11:122730476-122730498 GGCTTAGGATAGGCCTCTCTGGG - Intronic
1091639094 12:2221017-2221039 TGGTCAGGGAGGTCCCCTCTGGG + Intronic
1091767380 12:3130449-3130471 TGCTCTGGAAAGGCATCTCCAGG + Intronic
1096407907 12:51357268-51357290 TCCTCAGGAAAGGACTCTTTAGG + Intronic
1096799135 12:54097864-54097886 TGCTCTGGAAAACTCCCTCTAGG + Intergenic
1097274006 12:57799134-57799156 TGGTCAGGAAATGCCTCCCTGGG + Intronic
1097959268 12:65516586-65516608 TGGTCAGGGAAGGCCTCTCGGGG - Intergenic
1099105301 12:78488592-78488614 TGCTCAGGAAAGGCCTTGTTAGG - Intergenic
1100948022 12:99809336-99809358 TTTTCAGATAAGGCCCCTCTGGG + Intronic
1101140656 12:101792277-101792299 TGCTCAGGGAACTCGCCTCTGGG - Intronic
1101302949 12:103500427-103500449 TGCCCAGTAAAAGCCCCTCCTGG + Intergenic
1101701262 12:107176471-107176493 TGGTCAGGAAAGGCATCTCTGGG + Intergenic
1102403056 12:112647641-112647663 TGGTCAGGAATGGCCTCTCTAGG + Intronic
1103015966 12:117494793-117494815 TGCCCAGGGAAAGCCACTCTGGG + Intronic
1104224934 12:126822489-126822511 TTTTCAGGAGAGGCCTCTCTGGG + Intergenic
1105324308 13:19356072-19356094 TTGTCAAGAAAGGCCTCTCTTGG - Intergenic
1105958179 13:25303599-25303621 AGGTCAGAAAAGGCCTCTCTGGG - Intronic
1106466645 13:30019797-30019819 TGCTCAGGAAATTCCCCTGGAGG - Intergenic
1109720464 13:66269213-66269235 TGCTCCTGAAATGCCCCTTTGGG - Intergenic
1113991489 14:16030758-16030780 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1114216760 14:20663075-20663097 TGATCAGGAAAGGTTTCTCTGGG + Intergenic
1118838080 14:69490707-69490729 TGCTCAGGAAATGCTCATCCTGG - Intronic
1119130515 14:72168329-72168351 GGCTCAGGAAAGGCTCCTTCAGG + Intronic
1120854268 14:89199412-89199434 TGGAGAAGAAAGGCCCCTCTTGG - Intronic
1121195919 14:92071816-92071838 TGGTCAGGAAAGGCATCTCTGGG - Intronic
1121610219 14:95273552-95273574 TGCTCAGGAAAGGCCCTGAAAGG + Intronic
1121665021 14:95665738-95665760 TGCTCAGTAAAGCCCCCTACTGG + Intergenic
1121669768 14:95699605-95699627 CCTTCAGGCAAGGCCCCTCTGGG - Intergenic
1121684803 14:95827838-95827860 TGCTCAGGAAGTGGCCCTCGGGG + Intergenic
1121818828 14:96949531-96949553 TTCTCTGTCAAGGCCCCTCTGGG + Intergenic
1122112688 14:99513314-99513336 AGCTGAGCAGAGGCCCCTCTGGG - Exonic
1202848475 14_GL000225v1_random:1198-1220 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1202853644 14_GL000225v1_random:36965-36987 GGCTCAAGAAAGCCCCCTGTGGG - Intergenic
1202859512 14_GL000225v1_random:72602-72624 AGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202862188 14_GL000225v1_random:89891-89913 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1202921967 14_KI270723v1_random:35273-35295 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1202927485 14_KI270725v1_random:2638-2660 TACTCAGAAAAGGCCTCTCTGGG + Intergenic
1127681095 15:61299179-61299201 TGCTTGGGAAAGGCCCATCTGGG + Intergenic
1128235175 15:66062081-66062103 TGATCTGGGAAGGCCTCTCTGGG + Intronic
1128521252 15:68376316-68376338 TCTTCAGGAAAGGCCGCTTTGGG - Intronic
1129333731 15:74840432-74840454 TCCTCAGGCAAGGCCTCTCTGGG - Intronic
1129545548 15:76391239-76391261 TGGTCAGGAACGGCCTCTCTGGG - Intronic
1131530906 15:93190900-93190922 TGCTCAGGAAAGGCCGGGCGCGG - Intergenic
1131813533 15:96199143-96199165 TGGTCAGGGAAGGCCTCTCTGGG - Intergenic
1131880812 15:96860129-96860151 TTCTCAGGATTGGCTCCTCTTGG + Intergenic
1132465836 16:77161-77183 AGCTCAGGAAAAGCCCCTCGAGG + Intronic
1132994306 16:2815088-2815110 TGCTCAGTAAATCCCTCTCTTGG - Intergenic
1135573566 16:23567761-23567783 TGCTCAGGCCAGGCCCCTGATGG - Intronic
1135893475 16:26377504-26377526 TGGTCAGGAAAGGCCCCCTGAGG + Intergenic
1135957890 16:26971570-26971592 TGATCAGGGAAGGCCTCTCTGGG - Intergenic
1137306595 16:47206900-47206922 TGATCAGGGAGGGCCTCTCTTGG - Intronic
1137753976 16:50887042-50887064 TGGTCAGGGAAGGCCTCCCTGGG + Intergenic
1138292392 16:55858880-55858902 TGGTCAGGAAACGCTCTTCTAGG - Intronic
1139422436 16:66856913-66856935 TGCCCAGGGAGGGCCCCTCTGGG - Intronic
1141435831 16:83999234-83999256 TACTCAAGAATGGCCCCTCGTGG - Intronic
1142150807 16:88511838-88511860 TGCACGGGAAAGGTGCCTCTTGG - Intronic
1144246845 17:13374888-13374910 TGCTCAGGAACGGTCCCAGTTGG - Intergenic
1145219743 17:21078378-21078400 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1146507497 17:33417893-33417915 TCCTCAGGGAAGGCCCGACTAGG + Intronic
1146654250 17:34626073-34626095 TGGTCAGGAGAGGCCACGCTGGG - Intronic
1148045007 17:44738126-44738148 TGCAGAGGAAGGGCCCATCTAGG + Intronic
1148089336 17:45013471-45013493 ATCTAAGGTAAGGCCCCTCTTGG - Intergenic
1149798521 17:59544231-59544253 TCATCAGGAAAGGCTTCTCTGGG + Intergenic
1150465495 17:65389202-65389224 TACTCAGGAAAGGACCTACTTGG + Intergenic
1152260083 17:79262134-79262156 TGCTCTGGAAAAGCCTCTCGTGG + Intronic
1152753654 17:82078015-82078037 AGCTGAGGAGAGGCCCCTCGTGG - Intergenic
1158998981 18:62953460-62953482 TTCTCTGGAAAGGCCTCTCTGGG + Intronic
1162252312 19:9456072-9456094 GGCTCAGGATTGGCCCCTCATGG - Intergenic
1162283146 19:9716572-9716594 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1162320237 19:9967253-9967275 TGCGCACGGAAGGACCCTCTGGG + Intronic
1162419047 19:10555390-10555412 GGCTCAGGGAAGGCCCCGCCTGG - Intronic
1163036515 19:14572221-14572243 GGCTCAGGGAAGTCCCCTCTCGG - Intergenic
1164398508 19:27886926-27886948 TGATGAGGAAAGGCCTCACTAGG - Intergenic
1165041309 19:33069737-33069759 TGGCCAGGAAATGCCCCGCTGGG - Intergenic
1166007394 19:39916842-39916864 TGATCAGGGAAGGCCTTTCTGGG - Intronic
1166123278 19:40698788-40698810 TGCTTTAGAAAGACCCCTCTGGG + Intronic
1166659123 19:44634207-44634229 GGCCCAGGACAGGCCCCTCATGG + Intronic
1166663552 19:44663124-44663146 TGCTCAGGACACGCTCCTATAGG + Exonic
1166742415 19:45122432-45122454 TGCCCAGTAAAGACCCTTCTGGG + Intronic
927386906 2:22544992-22545014 TGGTCAGGGAAGACTCCTCTAGG - Intergenic
928424049 2:31163520-31163542 TACCCAGGAATGGCCCTTCTTGG + Intergenic
928576919 2:32664754-32664776 TGGTCAGGAAACACCCCTATGGG - Intronic
929249718 2:39739418-39739440 TAGTCAGGAAAGGCCTCTCTGGG - Intronic
935025817 2:99275951-99275973 GGCTCAGGACGGGCCCCTCATGG + Intronic
937332906 2:121043248-121043270 TGCCCAGGGCCGGCCCCTCTGGG - Intergenic
938550162 2:132373016-132373038 ATCTCTGGTAAGGCCCCTCTTGG - Intergenic
938638684 2:133256803-133256825 TGCTCAGGTAAGTGCCCTTTGGG + Intronic
946243314 2:218370238-218370260 ACTTCAGGAAAGGCCTCTCTAGG + Intergenic
946685581 2:222266278-222266300 TTCCTAGGAAAGCCCCCTCTGGG + Intronic
947344654 2:229178314-229178336 TGCTCAGGACAGGCATCTCCTGG + Intronic
948793747 2:240391878-240391900 TGCTCAGGCCGGGCCCCTCTCGG + Intergenic
948902624 2:240964098-240964120 GGCTCTAGAAAGGCCCCTGTGGG + Intronic
948982376 2:241500921-241500943 TGAACAGGAAAGGGCTCTCTCGG + Intronic
1168755869 20:317311-317333 TGGTCAGGACAGTCCTCTCTGGG + Intergenic
1168952751 20:1813735-1813757 TGGTCAGGGAAGGCCTCTCTGGG + Intergenic
1169652825 20:7888608-7888630 TGCTTAGGAAAAGCCCCTTAGGG - Intronic
1171770389 20:29318928-29318950 CGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171780244 20:29410973-29410995 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171784423 20:29449183-29449205 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171797289 20:29576484-29576506 TGCTCTGGAAAACTCCCTCTAGG - Intergenic
1171813099 20:29761726-29761748 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1171824207 20:29879237-29879259 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1171850962 20:30307677-30307699 TGCTCTGGAAAACTCCCTCTAGG + Intergenic
1172622991 20:36331810-36331832 TGGTCAGGGAGGGCCTCTCTGGG + Intronic
1172777680 20:37416845-37416867 TGGCCAGGAAGGGCCTCTCTGGG - Intergenic
1172804111 20:37598848-37598870 TGGTCAGGGAAGGCCTCTCTAGG + Intergenic
1173315095 20:41936063-41936085 TGGTCTGGGAAGGCCTCTCTGGG + Intergenic
1173894161 20:46537607-46537629 TGGCCAGGAAAGGCCTCTCTGGG - Intergenic
1173975849 20:47186051-47186073 GGGTCAGGAAAGGCCTCTCCAGG - Intronic
1173994134 20:47324796-47324818 TGGTCAGAGAAGGCCTCTCTAGG - Intronic
1174245500 20:49176789-49176811 GGCTCAGGTGAGGCCCCTATTGG - Intronic
1174373181 20:50107924-50107946 TGCTCAGGGACGGCCTTTCTGGG + Intronic
1174503535 20:51002606-51002628 TGGTCAGGGAAGGCCTCTCTGGG + Intergenic
1174639456 20:52030744-52030766 TGGTTAGGAAAGACCCCACTGGG - Intergenic
1174714578 20:52744074-52744096 CGGTCAGGAAAGGCTTCTCTGGG - Intergenic
1175113648 20:56666422-56666444 TGTTCAACTAAGGCCCCTCTTGG - Intergenic
1175130849 20:56788545-56788567 TGGTCAGGGAAGGCCTCTTTGGG + Intergenic
1175406797 20:58740104-58740126 TGCTCCGGAAAGTTCCCTCATGG - Intergenic
1176180250 20:63746530-63746552 TGCTCAGGCCAGGGGCCTCTGGG + Exonic
1176589510 21:8631318-8631340 TACTCAGAAAAGGCCTCTCTGGG + Intergenic
1177224499 21:18236315-18236337 TGCTATGGAAAGGACCCTATAGG - Intronic
1178293189 21:31386955-31386977 TGCTCCGGCATGGCCCCGCTGGG + Intronic
1179578066 21:42320098-42320120 TGCTGGGGAAGGGCCCATCTGGG - Intergenic
1179718207 21:43300972-43300994 CGCTCAGGACAGGCCCCTGCTGG + Intergenic
1179775737 21:43660642-43660664 TGTTCTGGGAAGGCCTCTCTGGG + Intronic
1180272340 22:10608315-10608337 TACTCAGAAAAGGCCTCTCTGGG + Intergenic
1180315779 22:11276766-11276788 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1180898940 22:19357145-19357167 TGCTCAGGGGAGGCCCTTGTTGG - Intronic
1180974733 22:19842084-19842106 TGCTCAGGACAGGCCTGTCCAGG - Intronic
1181447201 22:22986419-22986441 TGCCCTGGAAAGGCCTCTCAGGG + Intergenic
1181494724 22:23281481-23281503 TGCCCAGGAGATGTCCCTCTCGG - Intronic
1181506977 22:23365588-23365610 TGGTTAGGAAAGGCTCCTCTGGG - Intergenic
1181828888 22:25542983-25543005 TGATCAGGGAAGGCCTCTCTGGG - Intergenic
1182026319 22:27121990-27122012 TGGTCAGAGAAGGTCCCTCTGGG - Intergenic
1182953957 22:34403391-34403413 TGATCAGAAAAGGCCTCTCAGGG - Intergenic
1183030305 22:35098901-35098923 TGGTCAGGGAAGGCCTCCCTGGG - Intergenic
1183295989 22:37029869-37029891 TGCCCAGCAAAGGTCACTCTGGG + Intergenic
1183414831 22:37676167-37676189 TGCCCAGGATGGGCCCTTCTAGG + Intronic
1183467546 22:37987226-37987248 TGCTCCGGAAAGGCCTCCTTGGG - Intronic
1184239334 22:43203738-43203760 GGCTCAGGAGAGGGCGCTCTTGG + Exonic
1184547311 22:45180032-45180054 TCCTCAGGCACGGGCCCTCTGGG + Intronic
1184565191 22:45287600-45287622 AGTTCAGAAGAGGCCCCTCTTGG + Intronic
1184859458 22:47165017-47165039 AGCACCGGATAGGCCCCTCTCGG - Intronic
1184912938 22:47548181-47548203 TGGTCAGGGAAGACCCCTCGAGG - Intergenic
949137793 3:590405-590427 TACTCAGAAAAGGCCTCTCTGGG - Intergenic
949494861 3:4621885-4621907 TCATCAGGAAAGGCAACTCTAGG - Intronic
949578854 3:5366250-5366272 TGCTCAGGACATTACCCTCTCGG - Intergenic
950032497 3:9862124-9862146 TGCTCAGGGAGGGCTTCTCTAGG - Intergenic
950643453 3:14363218-14363240 AGCTCAGGATCAGCCCCTCTGGG - Intergenic
951720086 3:25689085-25689107 TGGTCAAGAAAGGCCCCTTTAGG + Intergenic
954580357 3:51699910-51699932 TGCTCAGGAAAGGAGTCCCTTGG + Intronic
954640941 3:52097352-52097374 TCCACAGGAAAGGCACCCCTGGG + Intronic
954939015 3:54353848-54353870 GCCTCAGGAAAGGCCCCTCAGGG + Intronic
955577933 3:60386954-60386976 TGCTCTTGAAAGTCCCCACTTGG + Intronic
956809068 3:72846954-72846976 TGGTCAGGAAAAGCCTTTCTGGG - Intronic
959137685 3:102444985-102445007 TGCTCAGGAAAGGTCCACTTAGG + Intronic
959971739 3:112417185-112417207 TGGTCAGGGAAGGCCTCTGTGGG - Intergenic
960422727 3:117467356-117467378 TCCTCAGCAATAGCCCCTCTAGG + Intergenic
961323288 3:126093367-126093389 GGCCCAGGACAGGCCCCTCATGG - Intronic
963141232 3:141947866-141947888 TGGCTGGGAAAGGCCCCTCTGGG - Intergenic
963798320 3:149653574-149653596 TGCTCAGGAAAGGTGCCTTCAGG + Intronic
964623033 3:158734168-158734190 TGGTCAGGGCAGGCCTCTCTCGG + Intronic
965731643 3:171778521-171778543 TGGTCAGAAGAGGCCTCTCTGGG + Intronic
966002835 3:174971444-174971466 TTTTCAGGAAAGGCCTTTCTGGG - Intronic
968555294 4:1243780-1243802 TGGACAGCACAGGCCCCTCTGGG - Intronic
968947323 4:3671879-3671901 GGCAGAGGAAAGGCCCCTCCTGG - Intergenic
970044440 4:11835101-11835123 TACTCAGGGAAAACCCCTCTGGG + Intergenic
970891367 4:21048825-21048847 GACTCAGGATAGGCCCCACTAGG - Intronic
972387916 4:38585706-38585728 TGGTCAGGGAAGGCATCTCTGGG - Intergenic
976977799 4:91185606-91185628 GGCCCAGGACAGGCCCCTCATGG + Intronic
977890230 4:102301386-102301408 TGTTCAGAAAAGGTCCCTCAAGG - Intronic
981766477 4:148256158-148256180 TGCACTGGAAAAGCCCCTCTAGG + Intronic
983799880 4:171914214-171914236 TGCCCAGGAAAGTTCCCTTTGGG + Intronic
985446117 4:190022038-190022060 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
985451265 4:190065245-190065267 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985452256 4:190068540-190068562 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985453240 4:190071837-190071859 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985454230 4:190075130-190075152 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985455218 4:190078423-190078445 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985456206 4:190081723-190081745 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985457190 4:190085017-190085039 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
985458177 4:190088310-190088332 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985459166 4:190091610-190091632 GGCTCACGAAAGCCCCCTGTGGG - Exonic
985463419 4:190174379-190174401 GGCTCACGAAAGCCCCCTGTGGG - Exonic
988707824 5:33743015-33743037 TGGTCAGGGAAGGCTTCTCTGGG + Intronic
991421965 5:66451353-66451375 TGCTGAGGAAAGTCCACTCTGGG - Intergenic
991478289 5:67047471-67047493 TGGTCAGGAAAGGCCTCACTGGG - Intronic
992082878 5:73251740-73251762 TGGTCAAGAAAGGCCTCTCGAGG + Intergenic
995283922 5:110365237-110365259 TGGTCAGGGAAGGCTTCTCTGGG + Intronic
996810042 5:127506633-127506655 TGTTCAGGGAAGGCCTCCCTGGG + Intergenic
997569217 5:134913319-134913341 TGGTCTGGAAAGTCCTCTCTGGG + Intronic
997582320 5:135025720-135025742 TGGTCAGGCAAGGCCCTTCTGGG - Intergenic
997852847 5:137347850-137347872 TGCTCAGGAAGGGCACGTGTAGG - Intronic
997984750 5:138493032-138493054 TGAGCAGGAGAGGCCCTTCTGGG - Intergenic
998231164 5:140362214-140362236 TCCTCAGTAAAGACCCTTCTAGG - Intronic
1000411498 5:160938233-160938255 AGCACAGGTAAGGGCCCTCTGGG - Intergenic
1001129919 5:169055356-169055378 TGGTTAGGAAAGGCCTCTCTGGG + Intronic
1001239254 5:170055780-170055802 TGCTGAGGAGATGTCCCTCTGGG - Intronic
1002895131 6:1374596-1374618 TGATCAGGAAAGCCTTCTCTGGG - Intergenic
1004569708 6:16833344-16833366 AGATCAGGAAAGGCCTCTCTGGG - Intergenic
1007274244 6:40661761-40661783 AGAGCAGGAAAGGCCCCACTGGG - Intergenic
1007304025 6:40890562-40890584 TGCTCAGCACAAGCCCCTCTGGG - Intergenic
1007831633 6:44643373-44643395 TCCCCAGGGCAGGCCCCTCTGGG - Intergenic
1008219160 6:48834803-48834825 ATCTCTGGAAAGGCCCCTCTTGG + Intergenic
1010658263 6:78538455-78538477 TGGTCAGGAAAAGCCCCCTTAGG + Intergenic
1011652669 6:89521305-89521327 AGGTCAGGGAAGGCCTCTCTGGG + Intronic
1013279818 6:108625653-108625675 TTCTCTGGAAAGACCTCTCTTGG + Intronic
1013519307 6:110917958-110917980 GGCCCAGGACAGGCCCCTCATGG - Intergenic
1019951034 7:4372859-4372881 TGCTCAGAAAAGCACCTTCTGGG - Intergenic
1020910790 7:14127905-14127927 TGCTCATGAAAGGCTCCATTAGG + Intergenic
1023402834 7:39802864-39802886 CCCTCAGGAAAGGGGCCTCTGGG - Intergenic
1023863759 7:44229311-44229333 GGCTCTGGAGTGGCCCCTCTAGG + Intronic
1025640418 7:63362130-63362152 TGTTCAGTCAAGGACCCTCTGGG - Intergenic
1025642281 7:63385963-63385985 TGTTCAGTCAAGGACCCTCTGGG + Intergenic
1026569625 7:71517985-71518007 AGCTCATGAAAGGCCCCTGGGGG + Intronic
1028155313 7:87422716-87422738 TGCTCAGGAAAGGCCCCTCTGGG - Intronic
1032264767 7:130363171-130363193 TGCCCAGGGAAGGCCTCTATTGG + Intronic
1032534436 7:132650164-132650186 TGCTCAGGGAAGGTTTCTCTGGG - Intronic
1033581795 7:142744597-142744619 TGGTCAGGAAAGGTCTCTTTGGG - Intergenic
1034983009 7:155490372-155490394 TGCTCAGGACAGTCCTCCCTGGG - Intronic
1035885271 8:3284745-3284767 TGTTCACGAAATGCCCCGCTAGG + Intronic
1036971747 8:13362901-13362923 TGGTCTGGAAAGGCCTCTCTAGG - Intronic
1041097220 8:54361893-54361915 TGGTCAGGGGTGGCCCCTCTAGG + Intergenic
1041780634 8:61575101-61575123 TGGGCAGGAAAGGTCTCTCTGGG - Intronic
1043977846 8:86603101-86603123 TGGTCAGGAATGACCTCTCTAGG - Intronic
1043987143 8:86707401-86707423 TGGTCAGAAAAGGCCTCTCCAGG + Intronic
1045005999 8:97917291-97917313 TGCTCTGCAAATGCCCTTCTTGG + Intronic
1045635272 8:104178909-104178931 TGCTCAGGATGTGCCTCTCTAGG + Intronic
1045821208 8:106340476-106340498 TGATCAGGAAAGGCCTATCTAGG - Intronic
1048431234 8:134373365-134373387 TGCTCAGGTAAGGCCTCGCTGGG - Intergenic
1049398706 8:142415212-142415234 TGCTCAGGGAGGGGCCCTCCTGG + Intergenic
1049534050 8:143169851-143169873 TGGTCAGACAAGGCCCCTCCTGG + Intergenic
1051612127 9:18971141-18971163 TGCTGCAGAAAGGCCCCACTCGG - Intronic
1053377862 9:37623481-37623503 TTCAAAGTAAAGGCCCCTCTAGG + Intronic
1053748997 9:41234982-41235004 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1053788740 9:41670969-41670991 TGCTCTGGAAAACTCCCTCTAGG + Intergenic
1054156399 9:61643799-61643821 TGCTCTGGAAAACTCCCTCTAGG - Intergenic
1054177022 9:61882308-61882330 TGCTCTGGAAAACTCCCTCTAGG + Intergenic
1054337381 9:63818373-63818395 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1054476172 9:65574809-65574831 TGCTCTGGAAAACTCCCTCTAGG - Intergenic
1054660512 9:67698498-67698520 TGCTCTGGAAAACTCCCTCTAGG - Intergenic
1059393664 9:114017208-114017230 TGGACAGGAAAGCTCCCTCTTGG + Intronic
1061245689 9:129400408-129400430 TGCTCAGGGCAGGCCTCTCGGGG + Intergenic
1062443840 9:136585160-136585182 TGGGCAGGGAAGGCCTCTCTGGG + Intergenic
1062560805 9:137141038-137141060 TCCCCAGGAATGGCCCCTCCTGG - Intronic
1203772585 EBV:57232-57254 TGGATAGGAAAGGCTCCTCTAGG + Intergenic
1203445029 Un_GL000219v1:46062-46084 GGCTCACGAAAGCCCCCTGTGGG + Intergenic
1203364072 Un_KI270442v1:242721-242743 GGCTCACGAAAGCCCCCTGTGGG - Intergenic
1203377280 Un_KI270442v1:385682-385704 GGCTCACGAAAGCCCCCACTGGG + Intergenic
1203619522 Un_KI270749v1:109947-109969 TACTCAGAAAAGGCCTCTCTGGG + Intergenic
1186056592 X:5655563-5655585 TCCTCAGGAAATGACCCTCAGGG - Intergenic
1186561221 X:10615571-10615593 TTTTCAGGAAAGTCCCCTCTTGG + Intronic
1187708088 X:22027117-22027139 TGCCCAGGCAAGTCCCTTCTTGG + Intergenic
1187823845 X:23315316-23315338 TGGTCAGGCAAGGCCTCTCTGGG - Intergenic
1188648363 X:32597175-32597197 TGCTCATGAAAAGCTGCTCTAGG - Intronic
1189728827 X:43997385-43997407 TACTCAGGAAAGGCTGCCCTGGG + Intergenic
1191094269 X:56658534-56658556 TCATCAGGCCAGGCCCCTCTGGG - Intergenic
1191580704 X:62757764-62757786 GGCCCAGGATAGGCCCCTCATGG + Intergenic
1192818206 X:74615977-74615999 TGGTCAGGGAAGGCTTCTCTAGG - Intergenic
1194536111 X:95107302-95107324 GGCCCAGGACAGGCCCCTCATGG + Intergenic
1196828848 X:119760610-119760632 TACTGAGGAAAGCCCCATCTTGG - Intergenic
1198227752 X:134661400-134661422 TGCTCAGGTAATGCCACTCATGG - Intronic
1198808843 X:140514662-140514684 TGTTCAGGAAATGCCTCTTTGGG + Intergenic
1201176996 Y:11315526-11315548 GGCTCATGAAAGCCCCCTGTGGG - Intergenic
1201178122 Y:11322163-11322185 GGCTCACGAAAGCCCCCTGTTGG - Intergenic