ID: 1028157672

View in Genome Browser
Species Human (GRCh38)
Location 7:87449966-87449988
Sequence ACCTTTCCAGCTCTTTGTTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 258}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028157668_1028157672 7 Left 1028157668 7:87449936-87449958 CCTTAAACCAGTGGCTAAAGAAC 0: 1
1: 0
2: 0
3: 14
4: 199
Right 1028157672 7:87449966-87449988 ACCTTTCCAGCTCTTTGTTCTGG 0: 1
1: 0
2: 0
3: 26
4: 258
1028157669_1028157672 0 Left 1028157669 7:87449943-87449965 CCAGTGGCTAAAGAACCTTCCTG 0: 1
1: 0
2: 0
3: 8
4: 153
Right 1028157672 7:87449966-87449988 ACCTTTCCAGCTCTTTGTTCTGG 0: 1
1: 0
2: 0
3: 26
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028157672 Original CRISPR ACCTTTCCAGCTCTTTGTTC TGG Exonic
901547559 1:9970262-9970284 ACTTTTTCAGCTATTTCTTCTGG - Intronic
901655424 1:10766662-10766684 ACCTTTCTTTCTCTTTGTTTAGG - Intronic
904488420 1:30843154-30843176 TCCTTCCCTCCTCTTTGTTCAGG - Intergenic
907769194 1:57443019-57443041 AGATTTCAGGCTCTTTGTTCAGG - Intronic
907853302 1:58277518-58277540 ACCTTGCCAGCTCTGTGTGTTGG - Intronic
908233229 1:62126261-62126283 ACCTTTCCAGCTCCTTGACTGGG + Intronic
908536981 1:65087508-65087530 ACCTTTCCAACTCATTCTCCTGG - Intergenic
909368380 1:74855991-74856013 ATCTTTCCTGCTCTTTCTTGTGG + Intergenic
909374756 1:74926953-74926975 ATCTTTCTAGCTTTTTGTTGTGG - Intergenic
910106540 1:83637105-83637127 ACCTGTGCAGTTCGTTGTTCAGG - Intergenic
910642287 1:89476302-89476324 ACCTTTCTAGCTTTTTGATGTGG - Intergenic
911961338 1:104306999-104307021 ACCTCTCCAGGACATTGTTCTGG + Intergenic
915846518 1:159271570-159271592 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
916140850 1:161696189-161696211 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
916863364 1:168830671-168830693 AGCTTTCCTGGTCTTTGCTCTGG + Intergenic
918982651 1:191583509-191583531 ATCTTTCCAGCTTTTTGATATGG + Intergenic
920385134 1:205565948-205565970 ACCTCACCAGCTATTTGTCCAGG + Intergenic
920390704 1:205598874-205598896 TCCCTTGCAGCTCTGTGTTCTGG - Intronic
920962834 1:210679579-210679601 AACTGTCAAGCTCTTTGTCCAGG - Exonic
921465679 1:215484223-215484245 TCCTGTCCTGCTCTTTGTTCTGG - Intergenic
922358676 1:224800707-224800729 AGCTTGCCAGCTCTTGGTTCAGG + Intergenic
922768906 1:228171428-228171450 CACTTTCCAGCTCTCTGTGCCGG - Intronic
923981277 1:239326918-239326940 ACCTTTTCAACGCTTTGTCCTGG + Intergenic
924196207 1:241609833-241609855 ACCTTCCCACCTCTTGGTCCTGG - Intronic
924617710 1:245627517-245627539 ATCTTTCCAGCTCTCTGATGTGG - Intronic
924883966 1:248191991-248192013 ATATTTCCAGCTTTTTGTTGTGG - Intergenic
924918633 1:248602245-248602267 ATCTTTCCAGCTTTCTGTTATGG + Intergenic
1064693956 10:17947182-17947204 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1066611889 10:37257507-37257529 ATCTTTCCAGCTTTCTGTTGTGG + Intronic
1067726624 10:48775516-48775538 AACTTACCAGCTCTCTGGTCTGG + Intronic
1069185673 10:65419499-65419521 ACCTTTCCAGATCTTTGTAAAGG + Intergenic
1069198194 10:65580879-65580901 ACCTTTTCAGCATTTTATTCTGG + Intergenic
1071317171 10:84413257-84413279 ATCTTTCTAGCTCTTTGATATGG + Intronic
1071685122 10:87746736-87746758 ATCTTTCCCGCTCTTTGCTGTGG + Exonic
1072697850 10:97617322-97617344 ACCTATCCTTCTCTTTGTTCAGG - Exonic
1073743509 10:106439425-106439447 ACCTTTCCTGATTTCTGTTCTGG - Intergenic
1074816876 10:117148882-117148904 ACCTTCCCAGCTCTGAGCTCTGG - Intergenic
1075407117 10:122202606-122202628 ACCTTCCCATCTCTTTTGTCAGG - Intronic
1076896638 10:133316473-133316495 ACCTTTCCATCTCTGTGTCCAGG - Intronic
1076896830 10:133317234-133317256 GCCTTTCCATCTCTGTGTCCTGG - Intronic
1077166098 11:1139679-1139701 TCCTTTCCAGGTCTCAGTTCTGG - Intergenic
1078183400 11:9030863-9030885 ACCTTGCCAGCTCTGTGCCCTGG - Exonic
1079219080 11:18543299-18543321 CACTTTCCAGCTCTTCGATCGGG + Intronic
1079928978 11:26533688-26533710 CTCTCTCCAGCTTTTTGTTCTGG - Intronic
1080592248 11:33734602-33734624 GCCTTTCCTGCAGTTTGTTCCGG + Intronic
1082165582 11:48946464-48946486 AACCTTCCAGCTTCTTGTTCTGG - Intergenic
1083243081 11:61404166-61404188 ACCTTTCCAGCCCTTTGAGGAGG - Exonic
1085380698 11:76115293-76115315 ACCTCTCCAGCTATGTGCTCTGG + Intronic
1085448940 11:76619885-76619907 ACCTTCCCATCTCTTTTGTCAGG + Intergenic
1086852463 11:91826019-91826041 ATATTTCCAGCCCTTTATTCAGG + Intergenic
1087881558 11:103421740-103421762 ATCTTTCCAGCTTTTTGATGTGG - Intronic
1090397320 11:126427614-126427636 ACCTCTCCAGCTCCATTTTCCGG - Intronic
1092482134 12:8869219-8869241 AGCAATCCAGCTCTTTGATCTGG - Intronic
1093333439 12:17870923-17870945 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1094783192 12:33816975-33816997 ATCTTTCCAGCTTTTTGATGTGG - Intergenic
1095369188 12:41446058-41446080 ACCTTTTAAGCTTTTTGTTGAGG - Intronic
1097520911 12:60669920-60669942 ATCTTTCCAGCTTTTTGATGGGG + Intergenic
1097689243 12:62718838-62718860 ACCTTTGCAGCTCTGAGTTCTGG - Intronic
1100404571 12:94262371-94262393 CCCTTTCCAGCTCTTTCTACTGG + Intronic
1101339468 12:103829506-103829528 ACCTTTCTACATCTTTGTTTTGG + Intronic
1102177785 12:110888505-110888527 AGCTTCCAAGCTCTTTGTTAAGG + Intronic
1102303142 12:111785357-111785379 AGCTTTCCTGTTCTTTGTTCTGG + Intronic
1103171742 12:118826550-118826572 CCTTTTCCACCTCTTTCTTCTGG + Intergenic
1104084675 12:125463424-125463446 AGCTTTCCCCCTCTTTGTGCTGG + Intronic
1104604882 12:130180592-130180614 ACCTTTCCTGCTCCCAGTTCTGG + Intergenic
1104862679 12:131932366-131932388 CACTTTCCAGCTCAGTGTTCTGG + Intronic
1105226712 13:18441617-18441639 ATCTTTCCAGCTTTCTGTTGTGG + Intergenic
1107336786 13:39363817-39363839 AACTTTATAGCTTTTTGTTCTGG - Intronic
1108037770 13:46309464-46309486 ACATTTCTAGCTCTTTCTACTGG + Intergenic
1108940851 13:55950667-55950689 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1109096959 13:58131209-58131231 ATCTTTCCAGCTTTTTGATGTGG + Intergenic
1109801659 13:67387025-67387047 ATCTTTCCAACTCTTTGATGTGG - Intergenic
1109814033 13:67555862-67555884 ACCTTCACAGCTCTGTGTTGAGG + Intergenic
1110328560 13:74245115-74245137 AAATTTCCAGTTCTTTGTTTTGG + Intergenic
1111168184 13:84490859-84490881 AGCTTTCCAGTTCTTTACTCAGG - Intergenic
1111756107 13:92397968-92397990 ACCATTTCAGCTAGTTGTTCAGG + Intronic
1112276625 13:98027394-98027416 ACCTTTCTAGCTGTTTGTCCGGG + Intergenic
1112677980 13:101726503-101726525 ACATTTCCAGCACTTTGTGAAGG + Intronic
1112872010 13:103984194-103984216 TACTTTGCAGGTCTTTGTTCAGG + Intergenic
1114011168 14:18370104-18370126 ATCTTTCCAGCTTTCTGTTTTGG + Intergenic
1116036748 14:39636639-39636661 ACCTTTCCTGCTTTCTCTTCTGG + Intergenic
1120638155 14:86976980-86977002 ACCTTTCCACCTTTTTGATGTGG - Intergenic
1122047908 14:99036422-99036444 CCTTCTCCAGCTCTTTGTTCTGG + Intergenic
1122777776 14:104129993-104130015 AGATTTCTAGCTCTTGGTTCTGG + Intergenic
1123574603 15:21654594-21654616 ACTTTCCCAGCTCTTGGCTCAGG + Intergenic
1123611217 15:22097090-22097112 ACTTTCCCAGCTCTTGGCTCAGG + Intergenic
1125038570 15:35156489-35156511 ACCTTTCAAGCTCTGTGTGTGGG + Intergenic
1125916408 15:43492058-43492080 TCTTCTCCAGCTGTTTGTTCAGG + Exonic
1126161413 15:45617163-45617185 ACCCATCCTGGTCTTTGTTCTGG + Intronic
1128213968 15:65921745-65921767 ACCCTACCAGCTCTTTGTGGGGG - Intronic
1128678173 15:69627040-69627062 ACCTTTCCTGCGCTCTGTGCTGG - Intergenic
1128857208 15:71029054-71029076 ATCTTTCCAGCTTTCTGTTTTGG + Intronic
1128887500 15:71302378-71302400 CCATTTCCAGCTGTGTGTTCTGG - Intronic
1131215377 15:90530886-90530908 ACCTCTCCAGGTGTTTGTCCCGG - Intronic
1131373435 15:91903711-91903733 ACGTGTCCAGCTCTGTGCTCAGG + Intronic
1131612957 15:93984210-93984232 TCTTGTCCAACTCTTTGTTCGGG - Intergenic
1131695157 15:94868754-94868776 ACATTTACAGCTCATAGTTCTGG + Intergenic
1202983467 15_KI270727v1_random:388846-388868 ACTTTCCCAGCTCTTGGCTCAGG + Intergenic
1133723461 16:8516341-8516363 ACCTTTCCAGCCATCTGCTCTGG - Intergenic
1135510242 16:23076546-23076568 ATCTTTCTAGCTCTGTGTCCTGG - Intronic
1140257578 16:73349989-73350011 GCCTTTCCAGTTCTTTATTCTGG + Intergenic
1140428004 16:74876871-74876893 ACCTTGCCAGCTCTGTTTTTGGG - Intronic
1140445646 16:75025487-75025509 ACCTGTTTAGCTCTTTGTTAGGG + Intronic
1140710341 16:77671744-77671766 CCCTTCCCAGCTCCATGTTCAGG + Intergenic
1145032247 17:19513260-19513282 CCCTTTCCAGGTCTTTTTCCTGG + Intronic
1146188949 17:30748080-30748102 TCCTTTCCAGCTCTTGTTTCTGG + Intergenic
1146333838 17:31952399-31952421 TCCTTTCCAGCTCTTGTTTCTGG + Intronic
1146469810 17:33115154-33115176 ATCTTTCCTGCTCCTTCTTCTGG + Intronic
1147749226 17:42718379-42718401 CCATTTCCTTCTCTTTGTTCTGG - Intronic
1149143312 17:53459424-53459446 AACTTTCCAGCACATTGATCTGG - Intergenic
1149313256 17:55416714-55416736 ACCTTTCCCATTCTTTTTTCGGG - Intronic
1152176525 17:78791636-78791658 AGCTGTCCAGCCCGTTGTTCTGG - Intronic
1153340388 18:3967340-3967362 ACCTTTGCAGATATTTGTCCTGG + Intronic
1153660725 18:7323552-7323574 CCCTCCCCAGCTCTGTGTTCTGG + Intergenic
1154526669 18:15297858-15297880 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1155520079 18:26658500-26658522 TCCTCTCTAGGTCTTTGTTCAGG + Intergenic
1157089398 18:44618461-44618483 ACCTCTCCAGGACATTGTTCTGG + Intergenic
1157482253 18:48062946-48062968 ACCTGCTCAGCTCTCTGTTCAGG + Intronic
1157566518 18:48682320-48682342 ACCTCTGCAGCTCTTTGCACAGG + Intronic
1158003630 18:52647283-52647305 ACCTTTCCAGCCCTTTGCACTGG + Intronic
1158754684 18:60307893-60307915 ACCTTCCCAACTCTGTTTTCAGG - Intergenic
1159083969 18:63766523-63766545 AACTTTCCAGTTCTATGTTGAGG + Intronic
1163029749 19:14536643-14536665 ATCTTCCCAACTCTGTGTTCAGG + Intronic
1163248675 19:16112727-16112749 ACCATTCCTGCTCTTTTCTCTGG + Intronic
1163291893 19:16384383-16384405 AACTTTCCAGCAGTTTCTTCCGG + Intronic
1163990156 19:20991231-20991253 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1163995733 19:21045182-21045204 ATCTTTCCAGCTTTTTGCTGTGG + Intronic
1164559394 19:29278616-29278638 ATCTCTCCAGCTCCGTGTTCTGG + Intergenic
1167774378 19:51545098-51545120 ACCTTACCTGCTATGTGTTCTGG - Intergenic
1167977265 19:53239807-53239829 ACCTCTTCAGCCCTTTGTTTTGG - Intronic
926179062 2:10624123-10624145 ACCTTCCCATCTCTTTTGTCAGG - Intronic
927572430 2:24171577-24171599 ACCTTTCCAAGTCTCTGTTTTGG + Intronic
928216779 2:29368258-29368280 ACCATCCCAGCCCTTGGTTCTGG - Intronic
928400628 2:30976137-30976159 ACATCTCCCACTCTTTGTTCTGG + Intronic
930543753 2:52740904-52740926 ACCCTTCTAACTCATTGTTCAGG + Intergenic
932437412 2:71710752-71710774 GCCTTTTCAGCTCTTTGCCCTGG + Intergenic
932941725 2:76174661-76174683 ACCTTTCTAGCTCTGTGATGTGG + Intergenic
933001817 2:76934640-76934662 ATCTTCCCAGCTCCATGTTCAGG - Intronic
933489305 2:82965253-82965275 ACCTTTCCAACTTTTTGTATGGG - Intergenic
934755764 2:96823588-96823610 CCATTTCCAGCTTTTTGTCCAGG + Intronic
937030752 2:118738056-118738078 GCCATTCTCGCTCTTTGTTCAGG + Intergenic
937701814 2:124870862-124870884 GCCTTTTCAGCTCTTTCTACTGG - Intronic
937904941 2:127048570-127048592 ACTTCTCCAGCTCCTTGTGCTGG + Exonic
938525763 2:132129222-132129244 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
939884647 2:147668232-147668254 ACATTTCCAGCTCTTTCTTTCGG + Intergenic
940073565 2:149716585-149716607 ACTTTTCCAAATCTTTGATCAGG - Intergenic
940535383 2:154934978-154935000 ACCTTTCCAGCAGTTAGTTGGGG + Intergenic
942720886 2:178951364-178951386 ACCTTTCCAGTTCCTAGGTCAGG + Intronic
943021818 2:182583604-182583626 AACTCTCCAGCCCTTTGTTTTGG + Intergenic
943356622 2:186864270-186864292 TCCTTTCCAGCTTCTTTTTCAGG - Intergenic
944341081 2:198600362-198600384 CCCTTTCCATCACTTAGTTCTGG + Intergenic
945038331 2:205723519-205723541 ACCTTTCCAGCTCATCTTCCAGG + Intronic
945073036 2:206010095-206010117 ACGGTTCCAGTTCTTTGTACTGG + Intronic
1169789051 20:9390319-9390341 TTCTTTCCAGCTCTTAGTTTTGG + Intronic
1169998721 20:11589913-11589935 ATTTTTCCAGATCTTTTTTCTGG + Intergenic
1170003400 20:11639870-11639892 ACATTTCAAGTTCTTTCTTCTGG - Intergenic
1170553718 20:17498851-17498873 ACCGGTCCAGCTCATTCTTCAGG + Exonic
1172265093 20:33604850-33604872 ACATTTCCAGCTCTTCCATCTGG - Intronic
1173390776 20:42630516-42630538 ACCCATTCAGCTCTTTGTTGGGG - Intronic
1176770762 21:13070641-13070663 ATCTTTCCAGCTTTCTGTTGTGG + Intergenic
1179544983 21:42107791-42107813 CCCTCTCCAGCTTGTTGTTCTGG + Intronic
1180435662 22:15300908-15300930 AACTTTCCAGCTTTCTGTTGTGG + Intergenic
1181096698 22:20509858-20509880 ACCCTTCCAGTTCTTAATTCTGG - Intronic
1183082055 22:35463023-35463045 GCCTTCCCAGCCCTTTGTTCTGG + Intergenic
1183941175 22:41295745-41295767 ACCTTCCCATCTCTTTTGTCAGG + Intergenic
1184655361 22:45938751-45938773 ACATTTCCAGTTCTCTCTTCTGG - Intronic
950265237 3:11568603-11568625 ACATTTCCAGCTCATTTTCCTGG + Intronic
950416674 3:12872889-12872911 CCCGTTCCTGCTCTTTGTTGGGG - Intergenic
951570861 3:24061774-24061796 ACACTTCCAGCTCTTTCTTCTGG - Intergenic
953592352 3:44270790-44270812 ACCTTTTCATCCCCTTGTTCAGG - Exonic
956779054 3:72590084-72590106 ACCCTTACAGCTCTTTGCACAGG + Intergenic
957607553 3:82422271-82422293 AGCTTGCCAGCCCTTTGATCTGG + Intergenic
959849468 3:111071031-111071053 ATTTTTCCTGCTCTTTTTTCTGG - Intronic
960847717 3:122020211-122020233 AGCTTTCCCTCACTTTGTTCAGG + Intronic
964183631 3:153916279-153916301 ATCTTTCTAGCTTTTTGATCTGG - Intergenic
966448363 3:180029568-180029590 CTCTTTCCAGCTCTTCTTTCAGG + Intronic
968855999 4:3122460-3122482 ACATTTCCTGCTCATGGTTCTGG - Intronic
970232448 4:13924903-13924925 ACCTCTCCTGCTCTTCCTTCTGG - Intergenic
970612755 4:17740883-17740905 ACCTTGCCGTCTCTTTGTCCTGG + Intronic
971282655 4:25254082-25254104 TCTTTTCCAGCTATTTTTTCAGG - Intronic
971285740 4:25288215-25288237 ATCTTTCTAGCTTTTTGTTGTGG + Intergenic
971868023 4:32197738-32197760 ACCTTTCTATCTGTTTGATCTGG + Intergenic
971952425 4:33371151-33371173 ACCTTTCCAGCTTTTTGATGTGG - Intergenic
972726126 4:41747432-41747454 CCCTTTCCAGCTCTTTGAGCTGG + Exonic
973120224 4:46512921-46512943 ACTTTTCCATCCCTTTCTTCAGG - Intergenic
973322105 4:48820434-48820456 ACCTTTCCAGCTTTCTGTTGTGG - Intronic
974650184 4:64744942-64744964 ACTATTCCAGCTCTTTTTTTTGG + Intergenic
975898920 4:79126840-79126862 ATCTTTCCAGCTTTTTGATGTGG + Intergenic
976116157 4:81729570-81729592 AACTTTCCAGGACATTGTTCTGG + Intronic
976902589 4:90197201-90197223 ACCTATCCATCTCTTTAATCTGG - Intronic
977236039 4:94508393-94508415 TTCCTTCCAGCTCTTTGTTTAGG - Intronic
977352762 4:95909247-95909269 ACCTTCCCAGCTCATTGCACTGG - Intergenic
977616893 4:99097044-99097066 ATCTTTCCTGCTTTCTGTTCTGG + Intergenic
978642104 4:110882876-110882898 ACATTTCAAGCGCTTTGTTCAGG + Intergenic
980102197 4:128552853-128552875 ACCTTTCAAGCTTTGTGATCAGG + Intergenic
981690036 4:147498250-147498272 ACTTTTCCTGCTTTTTGTTCTGG + Intronic
984330727 4:178313322-178313344 ACTTTTCCAGCCTTTTGTTCTGG - Intergenic
985429430 4:189864774-189864796 TCTATTCCAGCTCTTTGTCCTGG - Intergenic
985613688 5:906272-906294 ATATTTCCAGATCTTTGTACTGG - Intronic
986011575 5:3721493-3721515 ATCTTTCCAGCTTTTTGATGTGG + Intergenic
986166244 5:5273703-5273725 ACATTTCAAGCTCATTGTTTTGG - Intronic
986241505 5:5964276-5964298 AACTGGCCACCTCTTTGTTCAGG + Intergenic
986629693 5:9758971-9758993 ACCATTCCAGCTGCATGTTCTGG - Intergenic
992390604 5:76327334-76327356 ACCTTTGCAGTTTTTGGTTCGGG - Exonic
992979421 5:82152608-82152630 TCCTACCCAGCTCTTTGCTCAGG - Intronic
993375666 5:87147262-87147284 ATCTTTCTAGCTTTTTGTTATGG + Intergenic
996268971 5:121579377-121579399 ACCTTTCAATCTTTATGTTCTGG + Intergenic
996682503 5:126243099-126243121 ATCTCTCCAGCTCTTCCTTCTGG + Intergenic
998759487 5:145416681-145416703 ATCTTTCTAGCTTTTTGTTGTGG - Intergenic
1001039640 5:168325009-168325031 AGCTTTCCAGCTCTTTGCAGGGG + Intronic
1001152234 5:169242054-169242076 GCCTTTCTAGCTCTTTCTCCTGG - Intronic
1004983790 6:21057628-21057650 ATCTTTCTAGCTTTTTGATCTGG + Intronic
1005649321 6:27872096-27872118 ACCTTTTCAGCGCTTGGTACGGG - Exonic
1008043479 6:46827903-46827925 GCTTTTCCAGATCTTTCTTCTGG - Intronic
1008236810 6:49060668-49060690 ACCTTTCCTGCTTTCTGTTGTGG - Intergenic
1010596799 6:77773583-77773605 AACTTTCCAGCACATTGGTCTGG + Intronic
1010647863 6:78414325-78414347 AACTTTCCAGGACATTGTTCAGG + Intergenic
1010846798 6:80719804-80719826 CTCTTTCCATCTCTTAGTTCTGG - Intergenic
1012106315 6:95164525-95164547 ACCTTTCCAGTGCTTTATTTAGG - Intergenic
1013195727 6:107843834-107843856 ACCTTCCCATCTCTTTATTAGGG - Intergenic
1013733365 6:113196946-113196968 ACTTTACCAGCTCTTTATCCTGG + Intergenic
1016774603 6:147891604-147891626 ACATTTCCAGCTGATTGTTAAGG + Intergenic
1017678171 6:156836481-156836503 ACCATCCCAGCTCCTGGTTCTGG - Intronic
1019616274 7:1964076-1964098 CCCTTACCAGCTCTGTGATCAGG - Intronic
1019802802 7:3100742-3100764 CTCTTCCCAGCTCTGTGTTCAGG - Intergenic
1020935709 7:14461133-14461155 ACCTTTCCTGCTCTTTCCTGTGG - Intronic
1023860742 7:44216486-44216508 TCCATTCCAGCTCTCTGTCCTGG + Intergenic
1028157672 7:87449966-87449988 ACCTTTCCAGCTCTTTGTTCTGG + Exonic
1030363697 7:108622968-108622990 GCCTTTCCGGCTTTTTGTTTTGG + Intergenic
1031584662 7:123519805-123519827 ACCTTGTCATTTCTTTGTTCTGG - Intronic
1031593110 7:123618074-123618096 CCCTTTCCACCTCTTGCTTCTGG - Intronic
1033678015 7:143563424-143563446 TTCTTTGCAGCACTTTGTTCTGG + Intergenic
1033693824 7:143766020-143766042 TTCTTTGCAGCACTTTGTTCTGG - Intergenic
1034044893 7:147917410-147917432 CTCCTTCCAGCTCTCTGTTCTGG + Intronic
1037028521 8:14071195-14071217 ATCTTTCCAGTTTTTTGTTGCGG - Intergenic
1037226235 8:16594564-16594586 ACCTTGCCAGCTATATCTTCTGG - Intergenic
1037859088 8:22392119-22392141 ACTTTTCCAGCACTTTTCTCTGG - Intronic
1043496069 8:80801698-80801720 ACCTTTCTAGCTTTTTGATGTGG - Intronic
1044145025 8:88702132-88702154 ACATTTCCAGCTCTATGCTGAGG - Intergenic
1044671598 8:94686484-94686506 ATCCCTTCAGCTCTTTGTTCAGG + Intronic
1046533304 8:115474993-115475015 AGCTTTCCATATTTTTGTTCAGG - Intronic
1046969801 8:120209479-120209501 ACATTTCCAGCTCCTTGTACAGG - Intronic
1046994698 8:120504809-120504831 AACTTTTCTGCTCTATGTTCTGG + Intronic
1049202736 8:141349894-141349916 ACCCTTCCATAGCTTTGTTCTGG + Intergenic
1050704556 9:8382430-8382452 CCCATTCCAGCTCTTTACTCAGG + Intronic
1050806906 9:9692198-9692220 AACTCTCCAGCACATTGTTCTGG - Intronic
1051218093 9:14820470-14820492 CCTTTACCAGCTCTTTCTTCAGG - Intronic
1052143750 9:25022662-25022684 ATCTTTCCAGCTTTTTGATGTGG + Intergenic
1053704475 9:40736651-40736673 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1054414560 9:64860261-64860283 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1055444924 9:76373105-76373127 ACTTTTCCAACTCTTTTCTCAGG - Intergenic
1056067250 9:82949398-82949420 ATCCTTACAGTTCTTTGTTCTGG - Intergenic
1056719811 9:89061993-89062015 AACTTTCCATGTCTTGGTTCAGG + Intronic
1056979145 9:91292178-91292200 ACCTCTTCAGCTCTAAGTTCAGG + Intronic
1056979553 9:91296464-91296486 ACCTATTAAGCTCTTTGGTCTGG - Intronic
1058242625 9:102585070-102585092 ACCTTACCAGCTATTTATGCTGG + Intergenic
1059020737 9:110573800-110573822 AGCTCTTCAGCTGTTTGTTCTGG - Intronic
1059508206 9:114819088-114819110 ATCCTTCTTGCTCTTTGTTCAGG - Intergenic
1059556343 9:115284416-115284438 ACCTTTTCAGCCCTTGGCTCAGG - Intronic
1060336863 9:122732559-122732581 ACCTTTCCAGCTTTTTGATGTGG - Intergenic
1062298012 9:135844484-135844506 ATCTTTCCAGCTTTCTGTTATGG - Intronic
1186166663 X:6833714-6833736 ACATTTACAGCTCTGTGATCTGG + Intergenic
1186310479 X:8312510-8312532 AGCTTTACAGCTCTGGGTTCAGG - Intergenic
1187348410 X:18489066-18489088 CCCTTTCCAGGTCTTTTTCCTGG + Intronic
1189266537 X:39720933-39720955 AGCTTTCCAGCTCTTTTCTACGG + Intergenic
1189615025 X:42774340-42774362 ACCTTTCCAGGGGATTGTTCTGG - Intergenic
1190687965 X:52890986-52891008 CCCTTTCCAGGTCTTTTTCCTGG - Intergenic
1190698017 X:52964806-52964828 CCCTTTCCAGGTCTTTTTCCTGG + Intronic
1191161750 X:57336779-57336801 ACCTTTCTAGCTTTTTGATGTGG - Intronic
1191876838 X:65806507-65806529 ACCTTTGCAACTCTTGGGTCAGG + Intergenic
1192095639 X:68207710-68207732 ACCTTTCTAGCTTTTTCTTTTGG + Intronic
1192701500 X:73479416-73479438 ATCTTTCCAGCTTTCTGTTGTGG + Intergenic
1194314996 X:92366601-92366623 TTCTTTCCAGCTCTCTGTTGTGG + Intronic
1194467726 X:94254817-94254839 ACCTTTACATCTCTGGGTTCAGG + Intergenic
1196367529 X:114940356-114940378 ACCTTTCCTGCTTTCTGTTGTGG + Intergenic
1197235044 X:124052281-124052303 ACCTTTTCATCACTTTATTCTGG + Intronic
1197506291 X:127308824-127308846 ATCTTTCCAGCTTTCTGTTGTGG - Intergenic
1197516307 X:127434321-127434343 ATCTTTCCAGCTTTTTGATGGGG + Intergenic
1198000792 X:132433677-132433699 ACCTTTCCAGCTCCTGGAACAGG + Intronic
1198023786 X:132684793-132684815 TTCTTTCTAGTTCTTTGTTCAGG + Intronic
1198245647 X:134828838-134828860 ACTGTTTCAGCTTTTTGTTCTGG + Intronic
1199033054 X:143023303-143023325 ACCTTTTCAGCTCTTGTTTTGGG - Intergenic
1200623046 Y:5478127-5478149 ATCTTTCCAGCTCTCTGTTGTGG + Intronic
1201596363 Y:15674073-15674095 ATCTTTCCAGCTCTCTCTTGTGG + Intergenic
1201667200 Y:16471856-16471878 ACCTTTCCAGCTTTTTCTCTTGG + Intergenic