ID: 1028158072

View in Genome Browser
Species Human (GRCh38)
Location 7:87454852-87454874
Sequence TGCTAAAGGCTGAGACCGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028158072_1028158076 4 Left 1028158072 7:87454852-87454874 CCTGGCGGTCTCAGCCTTTAGCA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1028158076 7:87454879-87454901 AGCCTTCTAAGGAGGCACAGAGG No data
1028158072_1028158078 23 Left 1028158072 7:87454852-87454874 CCTGGCGGTCTCAGCCTTTAGCA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1028158078 7:87454898-87454920 GAGGAGCCACTGAAGAGACAAGG No data
1028158072_1028158074 -7 Left 1028158072 7:87454852-87454874 CCTGGCGGTCTCAGCCTTTAGCA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1028158074 7:87454868-87454890 TTTAGCAAAGCAGCCTTCTAAGG 0: 1
1: 0
2: 0
3: 7
4: 123
1028158072_1028158075 -4 Left 1028158072 7:87454852-87454874 CCTGGCGGTCTCAGCCTTTAGCA 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1028158075 7:87454871-87454893 AGCAAAGCAGCCTTCTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028158072 Original CRISPR TGCTAAAGGCTGAGACCGCC AGG (reversed) Intronic
900406760 1:2496173-2496195 TGCTAAGGGCAGAGCCCGGCTGG - Intronic
900936704 1:5770655-5770677 TGCAAAAGGCTCACACCCCCTGG + Intergenic
900975491 1:6013683-6013705 TCCAAGAGGCTGAGACCGCAGGG - Intronic
901915763 1:12498693-12498715 TTCTAAAGGCTGAGAGGTCCAGG + Intronic
902745271 1:18469718-18469740 GGCTACAGGGTGAGACAGCCAGG - Intergenic
902992860 1:20201733-20201755 TGCTCAAGGCTGGGAGCTCCTGG - Intergenic
908994414 1:70134266-70134288 TGCTGAAGGCAGAGAACCCCTGG + Intronic
915128365 1:153680722-153680744 TGCCACAAGCTGAGACAGCCTGG - Intronic
921306734 1:213804417-213804439 TGCAAAAGCCTGAGAGTGCCTGG - Intergenic
923415006 1:233748327-233748349 TGCTAGAGGGTGAGACCACATGG + Intergenic
1066549430 10:36539184-36539206 TGCTGAAGGCTGAGGCCACATGG + Intergenic
1068276680 10:54808517-54808539 AGCTAAAAGATGAGACTGCCTGG - Intronic
1069821972 10:71233887-71233909 TGCTCTTGGCTGAGGCCGCCAGG + Intronic
1070470277 10:76772562-76772584 TGATAAAGGCTGAGGCAGCTTGG + Intergenic
1078107338 11:8366520-8366542 TGCTAGAGGCTGGGGCCACCTGG - Intergenic
1081993856 11:47351491-47351513 TGCTAAAAGCTGAGACTGAAGGG + Exonic
1087927248 11:103933242-103933264 TGAGAAAGGCTGAGAGCCCCTGG - Intronic
1090084861 11:123642001-123642023 TGCTAAAGTTTGAGAACCCCTGG + Intronic
1091716777 12:2783368-2783390 TGCTAAGACCTGAGACCTCCTGG - Intergenic
1092047173 12:5439929-5439951 TGCTAAAGACTGAGGTCCCCAGG + Intronic
1098812739 12:75116737-75116759 GGCTACAGGCTGAGACTGCCAGG - Intronic
1106862978 13:33931289-33931311 TGCTAAAGTCTGAGAACCACTGG - Intronic
1110578862 13:77094728-77094750 TACTAAAGGCTCAGACCCTCTGG + Intronic
1112372889 13:98810363-98810385 TGCTAAGTGCTAAGACTGCCAGG + Intronic
1118005872 14:61563782-61563804 TGCTCAAGTCTGAGAACCCCTGG + Intronic
1119191688 14:72687220-72687242 CACAAAAGGCTGAGACCTCCAGG + Intronic
1121340274 14:93100897-93100919 TGCTTCAGGCTGGGACCCCCTGG - Intronic
1122302340 14:100738381-100738403 GGCTAAGGGGTGAGCCCGCCCGG + Intergenic
1128620066 15:69141408-69141430 GGCTGAAGGCTGAGCCTGCCGGG + Intergenic
1129825384 15:78631402-78631424 TGCAAAAGGCTGTGAGCTCCAGG + Intronic
1132807524 16:1782066-1782088 TGCAAAAGGCTGCGAGGGCCAGG + Intronic
1142400357 16:89855358-89855380 TGCTAGAGGCTGGGGCAGCCAGG + Intronic
1144022425 17:11249207-11249229 TGCTGAATGCTGAGACCTACCGG + Intronic
1144627026 17:16849200-16849222 TGCTAGAGGTTGAGGACGCCCGG - Intergenic
1145366208 17:22268738-22268760 TGGTACAGGCAGAGACGGCCTGG - Intergenic
1147887035 17:43691121-43691143 AGCAAAAGGCTGTGACCGCCTGG + Intergenic
1148912198 17:50949102-50949124 TCCGAAAGGCTGAGACCCACTGG + Intergenic
1151422638 17:74008461-74008483 TGATCAAGGCTGAGATCTCCTGG - Intergenic
1156686808 18:39659407-39659429 TCTTAAAGGCTGAGTCTGCCTGG - Intergenic
1162589073 19:11578906-11578928 TGCTTAAAGCTGGGGCCGCCAGG - Exonic
1167332790 19:48866838-48866860 TGCTAAGGGGTGTGACCGCAGGG - Intronic
927454500 2:23237948-23237970 TGGTAAGGGCTGAGTCCTCCTGG - Intergenic
930616131 2:53596319-53596341 GGCTATTGGCAGAGACCGCCTGG - Intronic
931629485 2:64285987-64286009 TTCTAAAGTCTGAGAACACCTGG - Intergenic
932211150 2:69931888-69931910 TGCTAAAGGAAGAGGCAGCCGGG + Intronic
937012055 2:118571839-118571861 TGCAAAATGCTCAGAGCGCCTGG - Intergenic
940857394 2:158740106-158740128 TGCTGAAGCCTTAGACCTCCTGG - Intergenic
1171471893 20:25378840-25378862 TGGGAAAGGCTGAGAAAGCCAGG - Intronic
1172583715 20:36067541-36067563 TGCTAAAGTCTGAGAACCACTGG + Intergenic
1173836685 20:46130541-46130563 TGGGAAAGGCTGAGACCCCTGGG - Intergenic
1175015920 20:55790483-55790505 TGATAAAGGCTGACACAGACAGG - Intergenic
1175726213 20:61320476-61320498 TGGTAGTGGCTGAGACCACCAGG - Intronic
1176119391 20:63447145-63447167 TGCCAAAGGATGAGGCTGCCAGG - Intronic
1182177449 22:28305317-28305339 TGCCACAGGCTGAAACCTCCTGG - Intronic
1182983304 22:34693191-34693213 TGATAATGGCTGAGACCTCTGGG - Intergenic
1184067039 22:42126939-42126961 TGCTGAAGGATGAGGCCGTCTGG - Exonic
1184069764 22:42140643-42140665 TGCTGAAGGATGAGGCCGTCTGG - Intergenic
1184071507 22:42150251-42150273 TGCTGAAGGATGAGGCCGTCTGG - Intergenic
950510573 3:13423622-13423644 TGCTAAAGGCTGAGAGCCCAAGG + Intergenic
953464156 3:43105159-43105181 TGCTAAAGTATGTGACCGTCAGG - Intronic
958875825 3:99615972-99615994 AGCTAAAGGATGAGAACGCATGG - Intergenic
960181432 3:114585064-114585086 TGTTAAAGGCTGGGACCCTCTGG + Intronic
961035871 3:123641235-123641257 TGCTGATGGCTGAGACCCCGGGG - Intronic
968634415 4:1670546-1670568 AGCTAAAGGCTGTGCCCGCCTGG + Intronic
972562850 4:40243830-40243852 TGCTAAGGGCTGAGCACTCCAGG - Exonic
976517491 4:85985421-85985443 TGCTAAAGGATGAGAACACATGG + Intronic
977572276 4:98641042-98641064 TGGTTAAGGGTGAGACTGCCTGG - Intronic
983249396 4:165327528-165327550 AGCCAATGGCTGGGACCGCCAGG + Intergenic
985888798 5:2700061-2700083 AGCTAAGGGCTCAGACCCCCGGG + Intergenic
987089378 5:14497587-14497609 TGCTACAGGCTGAGTCCAGCTGG - Intronic
989385180 5:40848351-40848373 GGCTACAGGCACAGACCGCCAGG + Intronic
996785114 5:127229531-127229553 TGCAAAAGGGTGAGGCTGCCAGG + Intergenic
1001634003 5:173196896-173196918 TGCTTGAGGCTGAGACCCACAGG + Intergenic
1005578950 6:27215607-27215629 TACTACAGGCTGACGCCGCCAGG + Intergenic
1010448617 6:75977290-75977312 TGCTAAAGACTTAAGCCGCCAGG + Intronic
1016249879 6:142028113-142028135 TGCTAAAGGATGAGAACACACGG + Intergenic
1017573931 6:155780321-155780343 TGCTGAAGGCTGAGACCCTCAGG + Intergenic
1024144143 7:46494292-46494314 TTCTAAAGGCAGAAACTGCCAGG + Intergenic
1025859812 7:65316072-65316094 TGCTCTAGGCTGAAACTGCCAGG - Intergenic
1028158072 7:87454852-87454874 TGCTAAAGGCTGAGACCGCCAGG - Intronic
1029036394 7:97526847-97526869 TGTTTATGGCTGAGGCCGCCAGG - Intergenic
1034359070 7:150478110-150478132 TGATCAAGGCTGAGGCCACCTGG + Exonic
1038679522 8:29653911-29653933 TGCTAAAGGCACATACAGCCTGG + Intergenic
1046616840 8:116486958-116486980 TGCTCAAGGCTCAGAGCACCAGG + Intergenic
1057792523 9:98133499-98133521 TGCTAATAACTGAAACCGCCTGG - Intronic
1059388087 9:113980813-113980835 TGCTAGAGGCAGAGTCCGACGGG + Intronic
1062532407 9:137007712-137007734 TGCCAAAGGCTGACCCGGCCCGG - Exonic
1188378457 X:29462574-29462596 TGCTAGAGGCTGTGACTCCCTGG - Intronic
1200984353 Y:9290194-9290216 TGGTACAGGCAGAGACAGCCTGG + Intergenic
1201038990 Y:9810318-9810340 TGTTAAAGGCCGAGATGGCCTGG + Intergenic
1202125798 Y:21567909-21567931 TGCTACAGGCAGAGCCAGCCTGG - Intergenic
1202126090 Y:21570050-21570072 TGGTACAGGCAGAGACAGCCTGG - Intergenic