ID: 1028160099

View in Genome Browser
Species Human (GRCh38)
Location 7:87475693-87475715
Sequence GGCCGCGGCGAGCAAAGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028160099_1028160116 21 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160099_1028160118 22 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160099_1028160112 16 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160112 7:87475732-87475754 CCCCGCCCCCCACGCGCGTCCGG 0: 1
1: 0
2: 1
3: 19
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028160099 Original CRISPR GGCCGCGGCGAGCAAAGTCC AGG (reversed) Exonic
900113657 1:1019894-1019916 CGCCGCCGCGAACAAAGCCCCGG - Intergenic
900201290 1:1407780-1407802 GGCCGCGGCGAGCCGAGGTCGGG - Intergenic
902404665 1:16176026-16176048 GGCTGCGGAGAGCAAAGCCCAGG + Intergenic
906240144 1:44237884-44237906 GGCCGCCGGGAGCCAAGGCCAGG - Intronic
907450288 1:54542070-54542092 GGCCGCACCAGGCAAAGTCCGGG - Intergenic
908443951 1:64183662-64183684 GGCAGAGGAGAGCAAAGTCCGGG - Intergenic
910163422 1:84298498-84298520 GGCCGCCACGCGCAAAGCCCCGG - Exonic
916694440 1:167221462-167221484 GGCGGCGGCGAGCACAATGCCGG + Intronic
918487560 1:185045611-185045633 GGCCGCGGCCAGCGGAGCCCTGG + Exonic
919822862 1:201483888-201483910 GGCTGCGGCCAGCAGAGCCCAGG - Exonic
921054193 1:211531793-211531815 GGCTGGGGTGAGCAAAGGCCTGG + Intergenic
1071532434 10:86400481-86400503 GGCGGCGGCGAGCCGAGACCAGG - Intergenic
1073577860 10:104640633-104640655 GGGAGCGGCGAGCAGAGTCCAGG + Intergenic
1075522463 10:123151152-123151174 GCTCGCGGCGAGCAAAGTGGAGG - Intergenic
1076691266 10:132224875-132224897 GGCCACGGCGAGGCCAGTCCTGG - Intronic
1077254651 11:1574729-1574751 GGCCGCGGCGAGGGACGTGCGGG + Intergenic
1084946654 11:72642367-72642389 GGCGGCTGCGAGCATGGTCCTGG - Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1088624649 11:111721035-111721057 GGCAGCTGCTAGCAAGGTCCTGG - Exonic
1103623694 12:122203877-122203899 GGCCGCGGGGTGCAAAGGCACGG - Intronic
1105743584 13:23354985-23355007 GCCGGAGGCGAGCAAAGTCAAGG - Exonic
1110999960 13:82165669-82165691 GGCAGCGGGAGGCAAAGTCCTGG - Intergenic
1113841404 13:113363688-113363710 GGACGGGCCGGGCAAAGTCCGGG - Intronic
1114035910 14:18626970-18626992 GGGCGAGGCGAGCACAGGCCTGG + Intergenic
1125485605 15:40108813-40108835 GGCGGCGGCGGGCACAGGCCGGG + Exonic
1136479365 16:30532319-30532341 GGCAGCGGGGAGCAAGGTGCTGG + Exonic
1146374796 17:32286846-32286868 GGCCTTGGTGGGCAAAGTCCGGG - Intronic
1148343938 17:46890900-46890922 GGATGAGGCGGGCAAAGTCCTGG - Intergenic
1148766942 17:50045089-50045111 GGGCCCGCCAAGCAAAGTCCTGG + Intergenic
1150101112 17:62424252-62424274 GGCGGCGGAGAGAAAAGTCCAGG + Exonic
1152650215 17:81489070-81489092 GCCCTCGGGGAGCAAAGTTCCGG - Intergenic
1157504790 18:48218674-48218696 GGCCAAGGAGAGCAGAGTCCAGG - Intronic
1160745407 19:709027-709049 GGCCGGGGCGGGCTAAGGCCTGG - Intergenic
1162344998 19:10113736-10113758 GGCCGTGGCCAGCAATGGCCTGG + Exonic
1162778702 19:12995784-12995806 GGCCGCGGCGAGGGGAGGCCCGG - Exonic
1165073372 19:33268172-33268194 GGCCCCGGGGAACAGAGTCCAGG + Intergenic
1165100313 19:33435142-33435164 GGCAGAGGAGAGCAAAGGCCTGG + Intronic
932690987 2:73913567-73913589 GGTCACGGCCAGCCAAGTCCAGG - Exonic
942748578 2:179264187-179264209 GGCCGCGGCCCGCAGAGACCGGG - Intronic
946803932 2:223451200-223451222 GTCCACGGCCTGCAAAGTCCAGG + Intergenic
1170623323 20:18011835-18011857 GGCTGCGGCGAGCAAGGAGCCGG - Intronic
1172277250 20:33686365-33686387 CGCCGCTGCCTGCAAAGTCCCGG + Exonic
1173750352 20:45470799-45470821 GGCCGCGGGGAACAATGTCCCGG - Intronic
1175859483 20:62142852-62142874 CGCCCCGGCGAGCAGAGGCCGGG - Intronic
1176242195 20:64080212-64080234 GGCCCCGCCGAGCAGAGTCGGGG - Intronic
1180460033 22:15554024-15554046 GGGCGAGGCGAGCACAGGCCTGG + Intergenic
1180876723 22:19178308-19178330 GGCCGCGCCGACCGAAGTCCGGG - Intronic
1182718066 22:32376066-32376088 GGGCTCTGGGAGCAAAGTCCTGG - Intronic
1185038178 22:48490276-48490298 GGCCGCGGCGAGCCCCCTCCGGG - Intronic
951844837 3:27074091-27074113 GGCCACTGTGAGCAATGTCCTGG + Intergenic
952822314 3:37495953-37495975 GGCCTCAGGGAGCCAAGTCCAGG - Intronic
953412975 3:42700739-42700761 GGCCCCGGCCAGCATAGGCCAGG + Exonic
954887760 3:53891646-53891668 GGCCGCGGGGCGCTAAGCCCGGG + Intronic
968441530 4:626862-626884 GGCAGCGGCCAGCAGAGACCTGG + Intronic
968850114 4:3073375-3073397 GGCCGTGGCGGGCAGGGTCCTGG - Intergenic
968876476 4:3270360-3270382 GGCCTCGGGGTCCAAAGTCCAGG - Intronic
970913299 4:21304407-21304429 CGGCGCGGCGCGCAGAGTCCCGG - Intronic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1017234787 6:152108169-152108191 GGCCGTGGCAAGCACATTCCTGG - Intronic
1021402015 7:20220110-20220132 GGCCGTGGGGTGCAGAGTCCAGG + Intergenic
1023861451 7:44219771-44219793 GGCCCCGGGCAGCACAGTCCTGG - Intronic
1024254762 7:47532190-47532212 GGCAGCGGTAGGCAAAGTCCTGG + Intronic
1028160099 7:87475693-87475715 GGCCGCGGCGAGCAAAGTCCAGG - Exonic
1032030264 7:128477115-128477137 GGCGGCGGAGAGAAAAGTCCAGG + Exonic
1033654364 7:143362808-143362830 GGCCGCGGCGAGCCGAGCCGGGG - Intergenic
1034189978 7:149206578-149206600 AGCCACGGAGAGCAAAGGCCGGG + Intronic
1034469076 7:151246148-151246170 AGCCGCAGAGAGCAAAGCCCTGG - Intronic
1035105131 7:156435663-156435685 GGCCGCTGGGAGCAAAGGCGCGG - Intergenic
1042859050 8:73295054-73295076 TGCCGCGGCGGGCACAGTCCGGG + Exonic
1043428424 8:80171418-80171440 GACCGCGGCGAGCAAGGTGAGGG - Intronic
1056748190 9:89323430-89323452 GAGCCAGGCGAGCAAAGTCCAGG + Intronic
1057358022 9:94347659-94347681 AGCCGCGGCGAGCAAGGAGCTGG + Intergenic
1057649727 9:96909958-96909980 AGCCGCGGCGAGCAAGGAGCTGG - Intronic
1057900407 9:98943902-98943924 GGCGGCGGCGGGCAGAATCCCGG - Exonic
1062448103 9:136604195-136604217 GGCCGGGGTGGGCAACGTCCTGG + Intergenic
1189179199 X:38987413-38987435 GGCCAGGGCGAGCACAGGCCTGG + Intergenic
1190050296 X:47144557-47144579 GGACGGGGCGACCACAGTCCTGG + Exonic
1190745293 X:53318927-53318949 GGCTGCTGCGAGCTCAGTCCGGG - Intronic
1198155428 X:133955251-133955273 GTCCCCTGTGAGCAAAGTCCTGG - Intronic