ID: 1028160099

View in Genome Browser
Species Human (GRCh38)
Location 7:87475693-87475715
Sequence GGCCGCGGCGAGCAAAGTCC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 70}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028160099_1028160112 16 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160112 7:87475732-87475754 CCCCGCCCCCCACGCGCGTCCGG 0: 1
1: 0
2: 1
3: 19
4: 236
1028160099_1028160116 21 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160099_1028160118 22 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028160099 Original CRISPR GGCCGCGGCGAGCAAAGTCC AGG (reversed) Exonic