ID: 1028160116

View in Genome Browser
Species Human (GRCh38)
Location 7:87475737-87475759
Sequence CCCCCCACGCGCGTCCGGCC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 144}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028160103_1028160116 -6 Left 1028160103 7:87475720-87475742 CCCCGCCCCCGCCCCCGCCCCCC 0: 14
1: 170
2: 449
3: 2682
4: 11272
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160104_1028160116 -7 Left 1028160104 7:87475721-87475743 CCCGCCCCCGCCCCCGCCCCCCA 0: 4
1: 40
2: 288
3: 1375
4: 7888
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160102_1028160116 -5 Left 1028160102 7:87475719-87475741 CCCCCGCCCCCGCCCCCGCCCCC 0: 91
1: 160
2: 656
3: 4846
4: 14217
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160100_1028160116 6 Left 1028160100 7:87475708-87475730 CCGCGGCCTCGCCCCCGCCCCCG 0: 1
1: 11
2: 145
3: 561
4: 2486
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160101_1028160116 0 Left 1028160101 7:87475714-87475736 CCTCGCCCCCGCCCCCGCCCCCG 0: 79
1: 135
2: 508
3: 1876
4: 8520
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160105_1028160116 -8 Left 1028160105 7:87475722-87475744 CCGCCCCCGCCCCCGCCCCCCAC 0: 5
1: 40
2: 396
3: 2544
4: 18083
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144
1028160099_1028160116 21 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG 0: 1
1: 0
2: 0
3: 12
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028160116 Original CRISPR CCCCCCACGCGCGTCCGGCC CGG Exonic
900124069 1:1061868-1061890 CGCCCCACGCTGGCCCGGCCTGG - Intergenic
900244435 1:1630858-1630880 CCCCCCTCGCTCTTCCGTCCTGG + Intergenic
901045403 1:6393094-6393116 CCCCGGACGCCCGCCCGGCCGGG - Intronic
902145191 1:14392733-14392755 CCCCACACCCGCCTCCGCCCAGG - Intergenic
906637000 1:47416471-47416493 CCCCACGCCCGCGCCCGGCCCGG + Exonic
907185027 1:52602719-52602741 CCCCCATCCCGCGCCCGGCCCGG + Intronic
915458091 1:156053751-156053773 CCCCGCCCGCCCGGCCGGCCCGG + Exonic
915539467 1:156557698-156557720 CCCCCCCCGCGCCTCCCTCCCGG - Intronic
915539690 1:156558190-156558212 CCCCCCCCGCGCCTCCCTCCCGG - Intronic
916666947 1:166975402-166975424 CCCCGCCTGCGCGGCCGGCCCGG - Intronic
918040945 1:180913315-180913337 CCACCCCCGCCCGGCCGGCCCGG - Intronic
922467976 1:225857370-225857392 CCCCCCCCGCCCCGCCGGCCAGG - Intronic
924624667 1:245688463-245688485 CCCCCCGCGCGCCTCCGCCTCGG - Exonic
1063695660 10:8332684-8332706 CCGGCCCCGCGCGTCCAGCCTGG + Intergenic
1074137958 10:110644242-110644264 CCGCCCCCGCGTGGCCGGCCGGG + Intergenic
1076850059 10:133088297-133088319 CCCGCCCCGCGCGCCCGGCCCGG + Intronic
1077544971 11:3165243-3165265 CCCCGCGCGCCCGGCCGGCCCGG - Exonic
1080551285 11:33375993-33376015 CCGCTCCCGCGCGCCCGGCCGGG - Intergenic
1081831856 11:46121310-46121332 CCCCCCTCCCGATTCCGGCCCGG - Intergenic
1083822578 11:65181544-65181566 CACCCCACGCGCGCCCTGGCGGG - Exonic
1085284571 11:75351547-75351569 GCCCCCACGCGCCCCCCGCCGGG + Intronic
1089046107 11:115503562-115503584 CCCCCCCCGCGGGGCCGGGCCGG + Intronic
1100318554 12:93467748-93467770 CTCCCCACGGGCGTCCGCCAGGG - Intronic
1100391538 12:94149254-94149276 CCCCCCGCGCGGCCCCGGCCCGG + Exonic
1103341658 12:120224222-120224244 CCCCCCACCCCCGTCCAGCGAGG - Exonic
1103698561 12:122835708-122835730 CCCCTCACGCGCGAACGGCTGGG + Intronic
1103719593 12:122966210-122966232 CCCCCAACGCGTGCCTGGCCTGG + Intronic
1104049634 12:125186742-125186764 CTCCTCTCGCGCGCCCGGCCCGG - Intergenic
1104602491 12:130162816-130162838 CCGCCCATGCCCGCCCGGCCTGG - Exonic
1105403966 13:20118806-20118828 CCCCCCGCGCGGGTCTGCCCTGG - Intergenic
1110860512 13:80341031-80341053 GCCCCCGCGCCCGCCCGGCCCGG - Intergenic
1112344137 13:98576646-98576668 CCCCCTACGCTCAGCCGGCCGGG - Intronic
1113082748 13:106535262-106535284 CCCGCCAGCCGCGGCCGGCCCGG - Intergenic
1113737630 13:112689879-112689901 GCCCCCTCGCGCCTCCGCCCGGG - Intergenic
1113874279 13:113584858-113584880 CCCCGCCCGCGCGGCCGGACCGG + Exonic
1121174584 14:91881463-91881485 CCACCCCCACGCGTCTGGCCTGG - Intronic
1122162451 14:99793825-99793847 TGCCCCACGCGCCTCCGCCCGGG - Intronic
1122419273 14:101564945-101564967 CCCCGCACGCGCGGCTGGCCGGG + Intergenic
1123115615 14:105892810-105892832 TCCCCCACCTGCCTCCGGCCGGG - Intergenic
1123719143 15:23047826-23047848 CCCCCCAAGCACCTCTGGCCAGG - Intergenic
1123719828 15:23050188-23050210 CCCCCCCGGCACCTCCGGCCAGG - Intergenic
1128151052 15:65363652-65363674 CCCGCCACCCGCCTCCTGCCAGG + Intronic
1128263915 15:66252232-66252254 CCCCCCACCCCCCACCGGCCGGG + Intronic
1129780086 15:78264407-78264429 CCCCCGACGCCCGTCCGGCGCGG - Intronic
1129918283 15:79294297-79294319 CTCCCCACCCACGTCTGGCCAGG + Exonic
1129948221 15:79560540-79560562 CCCCGCCCGCGCGGCCGGACCGG - Intergenic
1132251954 15:100341259-100341281 GCCGCCCCGCGCGCCCGGCCCGG - Exonic
1132557981 16:580808-580830 GCCCCCAGGCGCGTCTGGCCGGG + Intronic
1132805146 16:1771801-1771823 CCCCCCGCGCCCCCCCGGCCAGG + Intergenic
1136003559 16:27313829-27313851 CCCGCCCGGCGCGCCCGGCCCGG - Intronic
1136029049 16:27489570-27489592 CGTCCCAAGCGCGGCCGGCCAGG - Intronic
1136556591 16:31010746-31010768 ACCCCCAGGCGCCCCCGGCCCGG - Intergenic
1137462748 16:48680261-48680283 CCCCCCACCCCCGACAGGCCTGG - Intergenic
1138516077 16:57536207-57536229 CCGCCCCCTCCCGTCCGGCCCGG + Intronic
1138619137 16:58197880-58197902 CCGCCCCCGCGGGCCCGGCCTGG - Exonic
1139484333 16:67247505-67247527 CCCTCCAGCCGCGTCCGGTCCGG - Exonic
1140462214 16:75148826-75148848 CCGCCCCCGCACGTTCGGCCAGG - Intronic
1141184704 16:81779192-81779214 CGCCCCAGGCGCGCCCAGCCGGG - Intronic
1141682573 16:85553222-85553244 CCCACCCCGCGCGCCCCGCCGGG - Intergenic
1141699062 16:85634142-85634164 CCCCCCACGCGCAGCCTGGCGGG - Intronic
1141830140 16:86505792-86505814 CCCCGCCCGCGCGGCCGGCCTGG + Intergenic
1144782211 17:17813942-17813964 CCCCACACCCGCCACCGGCCCGG + Intronic
1145750036 17:27349151-27349173 CCACCCTCGCGCGGCCGGGCGGG + Intergenic
1146058775 17:29593773-29593795 CCGGGCACGCCCGTCCGGCCTGG + Intronic
1146079151 17:29761454-29761476 GCCCCCACCCGCGTCCGGGGCGG + Intronic
1147317436 17:39627550-39627572 ACCCCCAGGCCAGTCCGGCCGGG - Intronic
1149992353 17:61390130-61390152 GCCCTCATGCGCGGCCGGCCCGG - Intronic
1152817723 17:82418306-82418328 CCCCCCACCCGGGTCGGGCCAGG + Exonic
1152924210 17:83080043-83080065 CCCCGCACGCTCGGCCGGCCCGG - Intronic
1155096368 18:22559808-22559830 GCCCCCGCGGGCGTCCGGGCCGG - Intergenic
1160909376 19:1467751-1467773 CCGTCCCCGCGGGTCCGGCCGGG - Exonic
1160947991 19:1652313-1652335 CCCCCCACGCGCCGCGTGCCCGG - Exonic
1161030630 19:2056344-2056366 CCACCCACCCACGTCCGGGCCGG - Intergenic
1161083187 19:2321657-2321679 CACCCCCCGCGCCCCCGGCCAGG + Exonic
1161364215 19:3868868-3868890 CCCGCCGCGTGCGCCCGGCCCGG - Intronic
1161560392 19:4969506-4969528 GCCCCCGCGCGCCCCCGGCCCGG - Intronic
1163698525 19:18775828-18775850 CCGCACACGCGCCCCCGGCCTGG - Intronic
1164693815 19:30228756-30228778 GCCCACACGCGAGGCCGGCCCGG - Intronic
1165349510 19:35268485-35268507 CCCCCAGCGCGCGTCCGCCCCGG + Intergenic
1165349859 19:35269504-35269526 CTCCCCGGGCGCGGCCGGCCCGG - Intronic
1165851391 19:38852053-38852075 CCCCGCCCCCGCGGCCGGCCCGG + Intronic
1166039114 19:40191589-40191611 CCCGCCACCCCCGCCCGGCCCGG + Intergenic
1167104538 19:47422221-47422243 CCCCCCGCCCGGGTCAGGCCGGG - Intergenic
1167649031 19:50719588-50719610 CCCCCCCCGCGGGCCGGGCCTGG + Intergenic
928606447 2:32947914-32947936 CCCACCGCGCGCGACCGCCCTGG - Intronic
933684847 2:85134207-85134229 CCCCCCACGCGCGCCCCACGGGG - Intronic
933886239 2:86720890-86720912 CCACCCTCGCGCCTCTGGCCCGG + Intronic
933923941 2:87075816-87075838 CCACCCTCGCGCCTCTGGCCCGG - Intergenic
935349777 2:102142999-102143021 CCCTCCACGGCCGTCCGTCCAGG + Exonic
935820253 2:106886770-106886792 CCCTCCCCGCGCCCCCGGCCCGG + Intronic
937203772 2:120223172-120223194 ACCCCAGCGCGCTTCCGGCCGGG - Exonic
938828976 2:135033671-135033693 CCCCGGACGGGCGGCCGGCCGGG + Intronic
942320246 2:174730181-174730203 GCACCCACGCACGTCCAGCCGGG - Intergenic
944675606 2:202033049-202033071 CCCCGCCCGCGCGCACGGCCTGG - Intergenic
945649263 2:212538611-212538633 ACCCCCACGCGCGCCCGGCTGGG - Exonic
946702230 2:222424889-222424911 TCCGCCACGCGGGGCCGGCCGGG + Intronic
948789028 2:240367783-240367805 CTCTCCACGGGCATCCGGCCTGG + Intergenic
949018185 2:241725320-241725342 CCCCGCCCGCACGCCCGGCCGGG - Exonic
1169006062 20:2207856-2207878 CGCCCCACGCGCACCCAGCCTGG + Intergenic
1175429341 20:58891162-58891184 CCCTCCGCCCGCGCCCGGCCGGG - Intronic
1176178687 20:63739924-63739946 CCCGCCCCGCGCCGCCGGCCGGG + Exonic
1176194400 20:63830835-63830857 CCCGCCCCGCGCCGCCGGCCTGG + Intronic
1176253648 20:64139409-64139431 CCCCCCACCCGCCTTCTGCCAGG - Intergenic
1179294572 21:40049740-40049762 CCTCCCATGTGCGTCCTGCCTGG + Intronic
1179495114 21:41766662-41766684 GCCCCCGCGCCCCTCCGGCCCGG + Intronic
1181000933 22:19987394-19987416 CCCCCCACCCACTGCCGGCCTGG + Intronic
1181456761 22:23064267-23064289 CCCCACACACACGTCCCGCCTGG + Intronic
1182903990 22:33920873-33920895 CCCGCCTCCCGCGCCCGGCCAGG + Intronic
1183211715 22:36455314-36455336 CCCCCCTCGGGGGTTCGGCCGGG - Intergenic
1183247272 22:36703469-36703491 CCCCCCACTCGCTACCGGCTGGG + Exonic
1184545567 22:45164606-45164628 CCCCCACCGCGCGCCCCGCCCGG - Intronic
1185317407 22:50185089-50185111 CCCGCCGCGCCCGTCCTGCCCGG - Intergenic
949987807 3:9553629-9553651 AGCCTCGCGCGCGTCCGGCCTGG - Intronic
950008301 3:9705067-9705089 CCCCCGCCTCGCCTCCGGCCTGG + Intronic
953246433 3:41198890-41198912 CCCCTAACCCGCGCCCGGCCGGG + Intronic
953564793 3:44022145-44022167 CCGCCCTTGCGCATCCGGCCCGG - Intergenic
963732660 3:148987716-148987738 CCCCGCTCGCCCGGCCGGCCCGG + Intergenic
966372134 3:179261331-179261353 CCCCCCCCGCGGGCCGGGCCAGG + Intronic
968523234 4:1043909-1043931 CACCCCAGGCCCGTCCGGCATGG - Intergenic
968613376 4:1566976-1566998 CCCCCCACCCCCGTCAGGTCAGG + Intergenic
968729255 4:2261985-2262007 CCGCCCGCGCCCGTCCGCCCCGG + Exonic
968872579 4:3249270-3249292 CCCCACAGGCGCCTCCGGCATGG + Exonic
971347618 4:25825956-25825978 GCCACCACGCCCGGCCGGCCTGG + Intronic
975395526 4:73869595-73869617 TACCCCAGCCGCGTCCGGCCCGG - Intronic
975409966 4:74038465-74038487 CACCCCAGCCGCGTCCGGCCCGG + Intronic
975415354 4:74098974-74098996 CACCCCAGCCGCGTCCGGCCCGG + Intronic
986402862 5:7396255-7396277 CCCGCCGTGCGCGCCCGGCCCGG - Exonic
993909513 5:93664112-93664134 CCCCCCACCCCCGCCCAGCCTGG - Intronic
997454076 5:134004790-134004812 CCCCTCCTGCGCGCCCGGCCCGG + Intronic
997892340 5:137687234-137687256 CCCCCCCCGCGCCTCCCTCCCGG - Intronic
1001382679 5:171314684-171314706 CCCCCCACCCCCGGCCTGCCTGG - Intergenic
1003427349 6:6006622-6006644 CCCCCTCCGCGCCTCGGGCCGGG + Intronic
1004262065 6:14117536-14117558 CCGCCCCCGCGCGCCCGGGCCGG - Intronic
1005940351 6:30555857-30555879 CCCCCCACGCACATCCGGGAGGG - Intronic
1013978217 6:116100829-116100851 CCGCCCCGCCGCGTCCGGCCCGG + Exonic
1019492838 7:1323169-1323191 CCCTCCACGCGCCTCCCACCCGG + Intergenic
1022112384 7:27239637-27239659 CCACCCACCCCCCTCCGGCCCGG + Intergenic
1022400182 7:30028816-30028838 CCCCCGGCGCGCCCCCGGCCCGG - Intronic
1023773735 7:43583478-43583500 CCCGCCCCGCGCGTCCGGGAAGG - Intronic
1028160116 7:87475737-87475759 CCCCCCACGCGCGTCCGGCCCGG + Exonic
1035125972 7:156607861-156607883 CCGCCGACGTGCATCCGGCCGGG + Intergenic
1035221343 7:157408199-157408221 CCCGGCCCGCGCGTCCTGCCAGG - Intronic
1035445818 7:158942384-158942406 CACCGCACGTGCCTCCGGCCGGG - Intronic
1035664824 8:1373260-1373282 GCCGCCACGCGCGTGCGGCCCGG + Intergenic
1038734513 8:30156673-30156695 CCCCCCCCGCCCTCCCGGCCGGG - Intronic
1044821253 8:96157620-96157642 CCCCCAACGCGTGGACGGCCTGG - Intronic
1049145885 8:141000953-141000975 CCCCTCCCGCGCCCCCGGCCCGG - Intronic
1049406302 8:142453113-142453135 CCCCCCTCGCCGGCCCGGCCCGG + Intronic
1056532465 9:87498764-87498786 CCCCGCGCGCGCGTGGGGCCGGG - Intronic
1057259644 9:93576598-93576620 CCCCGCGCGCGCTCCCGGCCAGG - Exonic
1057801287 9:98192730-98192752 CCCGCCCCGCGGGTCCGCCCTGG + Intergenic
1060974197 9:127755037-127755059 CCCGCCACGCGCGCCGGGCTGGG - Intronic
1061365971 9:130172615-130172637 CGCCCCAACCGGGTCCGGCCCGG + Exonic
1187281467 X:17860992-17861014 CCCGCCAGGCGCGCCCAGCCCGG + Intronic
1189336278 X:40172577-40172599 CCCTCAACACCCGTCCGGCCAGG - Intronic
1196031006 X:111096027-111096049 CCTCCCAGGCGCTTCCTGCCTGG + Intronic
1200047665 X:153411354-153411376 CCCCACAGGGGCGTCTGGCCTGG - Intergenic