ID: 1028160118

View in Genome Browser
Species Human (GRCh38)
Location 7:87475738-87475760
Sequence CCCCCACGCGCGTCCGGCCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 202}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028160105_1028160118 -7 Left 1028160105 7:87475722-87475744 CCGCCCCCGCCCCCGCCCCCCAC 0: 5
1: 40
2: 396
3: 2544
4: 18083
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160100_1028160118 7 Left 1028160100 7:87475708-87475730 CCGCGGCCTCGCCCCCGCCCCCG 0: 1
1: 11
2: 145
3: 561
4: 2486
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160102_1028160118 -4 Left 1028160102 7:87475719-87475741 CCCCCGCCCCCGCCCCCGCCCCC 0: 91
1: 160
2: 656
3: 4846
4: 14217
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160099_1028160118 22 Left 1028160099 7:87475693-87475715 CCTGGACTTTGCTCGCCGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 70
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160106_1028160118 -10 Left 1028160106 7:87475725-87475747 CCCCCGCCCCCGCCCCCCACGCG 0: 1
1: 3
2: 41
3: 377
4: 2792
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160103_1028160118 -5 Left 1028160103 7:87475720-87475742 CCCCGCCCCCGCCCCCGCCCCCC 0: 14
1: 170
2: 449
3: 2682
4: 11272
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160101_1028160118 1 Left 1028160101 7:87475714-87475736 CCTCGCCCCCGCCCCCGCCCCCG 0: 79
1: 135
2: 508
3: 1876
4: 8520
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202
1028160104_1028160118 -6 Left 1028160104 7:87475721-87475743 CCCGCCCCCGCCCCCGCCCCCCA 0: 4
1: 40
2: 288
3: 1375
4: 7888
Right 1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG 0: 1
1: 0
2: 0
3: 24
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028160118 Original CRISPR CCCCCACGCGCGTCCGGCCC GGG Exonic
900103864 1:974063-974085 CCCCCACGCCCGTGTGCCCCGGG + Intronic
902214306 1:14924629-14924651 CGCCCTCGCGCGCCCGGCCCCGG - Intronic
902870855 1:19312656-19312678 GCCCCTCGCCCGGCCGGCCCGGG - Exonic
903263356 1:22142927-22142949 CCGCCGCGGGCGCCCGGCCCGGG + Exonic
906466641 1:46087104-46087126 CCCCCACACACGACGGGCCCTGG - Intronic
906637002 1:47416472-47416494 CCCACGCCCGCGCCCGGCCCGGG + Exonic
909853769 1:80502652-80502674 CCCCCACCCACGACAGGCCCTGG - Intergenic
914509354 1:148317683-148317705 CCCCCAGGCGGCTCGGGCCCGGG - Intergenic
916635878 1:166667966-166667988 CCCCCACCCCCGACAGGCCCTGG - Intergenic
916694425 1:167221417-167221439 ACCCCGCGCCCGCCCGGCCCCGG - Intronic
918662647 1:187108386-187108408 CCCCCACCCCCGACAGGCCCTGG - Intergenic
918877239 1:190063640-190063662 CCCCCACGCCCGTCCGTCAAAGG - Intergenic
920029148 1:203026378-203026400 CCCCCAAGCGCCTCGGGTCCGGG - Intergenic
921138819 1:212285973-212285995 GCCCCACGGCCCTCCGGCCCCGG - Exonic
921618445 1:217299315-217299337 CCCCCACCCCCGACAGGCCCCGG + Intergenic
922603045 1:226871155-226871177 CCCCCGCGCGCCTCCTTCCCGGG - Intronic
922851366 1:228736022-228736044 CGGCCACGCGCCCCCGGCCCCGG - Intronic
924624665 1:245688462-245688484 CCCCCGCGCGCCTCCGCCTCGGG - Exonic
1063383990 10:5604491-5604513 CCCCCACGCACTCCCTGCCCGGG + Intergenic
1065845143 10:29737051-29737073 CCTCGGCGCGCGCCCGGCCCAGG + Intergenic
1068233372 10:54200426-54200448 CCCCCACCCTCGACAGGCCCCGG + Intronic
1068646701 10:59476066-59476088 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1070861999 10:79677244-79677266 CCCCCACCCCCGACAGGCCCTGG + Intergenic
1073777089 10:106798441-106798463 CCCCCACCCACGACAGGCCCTGG + Intronic
1074465396 10:113677386-113677408 CCCCCACCCGCAACAGGCCCCGG - Intergenic
1076089383 10:127668525-127668547 CCCCCACCCGTGACAGGCCCCGG + Intergenic
1076687275 10:132203849-132203871 CCGGCCCGCGCGTCCTGCCCAGG + Exonic
1077514255 11:2992182-2992204 CCCACCCGCCCGTCCGGGCCCGG + Intronic
1079275443 11:19031824-19031846 CCCCCACCCACGACAGGCCCCGG + Intergenic
1079550603 11:21692707-21692729 CCCCCACCCCCGACAGGCCCTGG + Intergenic
1081459497 11:43258813-43258835 CCCCAACCCGCAACCGGCCCTGG - Intergenic
1081831854 11:46121309-46121331 CCCCCTCCCGATTCCGGCCCGGG - Intergenic
1084153953 11:67303669-67303691 CCTCCACGCCCGTGGGGCCCTGG + Exonic
1087794828 11:102444530-102444552 CCCCCACCCACGACAGGCCCTGG - Intronic
1089046109 11:115503563-115503585 CCCCCCCGCGGGGCCGGGCCGGG + Intronic
1089378874 11:118013561-118013583 CCCCCACCCGCTTCTGGCACTGG - Intergenic
1090096395 11:123745986-123746008 CCCCCAGGCTCATCCTGCCCAGG - Intergenic
1090108220 11:123874681-123874703 CCCCCACGCCCCTCGGGCCCTGG + Intergenic
1096461240 12:51822173-51822195 TCCCTACGAGCGTCCGGCCCTGG - Intergenic
1097584174 12:61495294-61495316 CCCCCACCCCCGACAGGCCCCGG + Intergenic
1098106466 12:67072628-67072650 CCCCCACCCCCGACAGGCCCCGG - Intergenic
1099528354 12:83743158-83743180 CCCCCACACCCGACAGGCCCCGG - Intergenic
1100054008 12:90487318-90487340 CCCCCACCCCCGACAGGCCCCGG + Intergenic
1100186455 12:92145275-92145297 GGCCCAAGCGCGACCGGCCCCGG + Intronic
1100317203 12:93455270-93455292 CCCCCACCCCCGACAGGCCCCGG + Intergenic
1100391540 12:94149255-94149277 CCCCCGCGCGGCCCCGGCCCGGG + Exonic
1104880584 12:132067955-132067977 CCCCCATCCACGTCGGGCCCTGG - Intronic
1105034272 12:132907651-132907673 CCCCCACCCCCGACAGGCCCCGG + Intronic
1105409754 13:20161485-20161507 CGCCCACGCGCCTCCGACCGTGG - Intergenic
1106304184 13:28495316-28495338 TCCCCACGCGCGCTCGGCCCCGG - Intergenic
1108015286 13:46068695-46068717 CCCCCACCCCCGACAGGCCCCGG + Intronic
1113382736 13:109818489-109818511 CCCCCACCAGTGTCCAGCCCCGG - Intergenic
1113874281 13:113584859-113584881 CCCGCCCGCGCGGCCGGACCGGG + Exonic
1114525854 14:23366445-23366467 CCCCCACCCCCGTCCCGCCCTGG + Intergenic
1115538616 14:34397485-34397507 CCCCCACCCCCGACAGGCCCTGG - Intronic
1116553089 14:46267276-46267298 CCCCCACCCCCGACAGGCCCCGG - Intergenic
1116565890 14:46443637-46443659 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1117426893 14:55609154-55609176 CCCCCACCCGCAACAGGCCCTGG + Intronic
1129483031 15:75843134-75843156 CCCCCGCGCGCCCCCGCCCCCGG - Intergenic
1129948219 15:79560539-79560561 CCCGCCCGCGCGGCCGGACCGGG - Intergenic
1131692845 15:94845188-94845210 GCGACACGCGCGGCCGGCCCCGG + Intergenic
1132544691 16:527832-527854 CCCCGACCCGGCTCCGGCCCCGG - Intronic
1132972679 16:2696543-2696565 CGCCCACACGCGTTGGGCCCAGG + Intronic
1133234486 16:4381591-4381613 GCCGCAGGCGCGTCAGGCCCCGG - Exonic
1133801661 16:9090548-9090570 CCGCCACGCGGGTTCGGGCCGGG + Intergenic
1133802099 16:9092308-9092330 CCCCCGCCCGGGCCCGGCCCCGG + Intronic
1134800546 16:17080490-17080512 CCCCCACCCCCGACAGGCCCTGG + Intergenic
1136003557 16:27313828-27313850 CCGCCCGGCGCGCCCGGCCCGGG - Intronic
1136129612 16:28211666-28211688 CCCCCGCGGGGGTCGGGCCCGGG - Exonic
1136556589 16:31010745-31010767 CCCCCAGGCGCCCCCGGCCCGGG - Intergenic
1137618154 16:49858724-49858746 CCCCCACGCCCCCGCGGCCCAGG + Intergenic
1138516078 16:57536208-57536230 CGCCCCCTCCCGTCCGGCCCGGG + Intronic
1140164549 16:72536175-72536197 CCCCCACCCACGACAGGCCCCGG - Intergenic
1141168876 16:81678637-81678659 CCCCCCCGCGTGCCCGCCCCCGG + Intronic
1141830142 16:86505793-86505815 CCCGCCCGCGCGGCCGGCCTGGG + Intergenic
1142243837 16:88959401-88959423 CACCCACGTGCCTCCAGCCCTGG - Intronic
1142709392 17:1715293-1715315 CCCCCACCTCCCTCCGGCCCTGG - Intergenic
1143499210 17:7329242-7329264 CCCCCACCCCCGCCCGGCCCCGG + Exonic
1144184805 17:12787084-12787106 CCCCTACCCGCGACAGGCCCCGG + Intergenic
1144595816 17:16569270-16569292 CCCTCCCGCGCCTCTGGCCCTGG + Intergenic
1144782213 17:17813943-17813965 CCCACACCCGCCACCGGCCCGGG + Intronic
1145390935 17:22454812-22454834 CTCCCACGCGGCTCCGGGCCTGG + Intergenic
1146079153 17:29761455-29761477 CCCCCACCCGCGTCCGGGGCGGG + Intronic
1147317434 17:39627549-39627571 CCCCCAGGCCAGTCCGGCCGGGG - Intronic
1148111590 17:45147539-45147561 CCCCCGCCCGCCCCCGGCCCCGG + Intergenic
1148680389 17:49470330-49470352 CTCCCCCGCGCCTCCCGCCCAGG + Intronic
1150423291 17:65056957-65056979 CCTCCCCGCGCGCCCGGCCGCGG - Intergenic
1151677453 17:75605967-75605989 CCCGCCAGCGCGTCCTGCCCCGG + Intergenic
1152711134 17:81871033-81871055 CCCCGCCGCCCCTCCGGCCCGGG + Intronic
1152924208 17:83080042-83080064 CCCGCACGCTCGGCCGGCCCGGG - Intronic
1155096366 18:22559807-22559829 CCCCCGCGGGCGTCCGGGCCGGG - Intergenic
1155633733 18:27925706-27925728 CCCCCACCCCCGGCAGGCCCTGG + Intergenic
1160528972 18:79552686-79552708 CCCCCACGCCCGTGGGTCCCGGG + Intergenic
1160668473 19:344610-344632 GCCCCGCGCCCCTCCGGCCCCGG + Intronic
1160745326 19:708772-708794 CCGCCCCGCGCGCCCCGCCCCGG - Intergenic
1161210333 19:3062358-3062380 CCTCCCCGCGCGCCCGGCCCCGG + Intronic
1161240166 19:3218554-3218576 CCCCCAGGCCCGTCCAGCTCAGG - Intergenic
1161560390 19:4969505-4969527 CCCCCGCGCGCCCCCGGCCCGGG - Intronic
1161721008 19:5902719-5902741 CCACCATGCCCGGCCGGCCCTGG - Intronic
1161977193 19:7613199-7613221 CCCCCACCCGCCCCCGCCCCAGG - Intronic
1164693813 19:30228755-30228777 CCCACACGCGAGGCCGGCCCGGG - Intronic
1165236785 19:34428362-34428384 CCCCCACCCGCTTCCGGCCGCGG + Exonic
1165349512 19:35268486-35268508 CCCCAGCGCGCGTCCGCCCCGGG + Intergenic
1166222839 19:41376713-41376735 CCCCCGCGCGCAGCGGGCCCGGG + Exonic
1167940530 19:52942618-52942640 CCTCCCCGCGGGTCCCGCCCAGG - Intronic
1167987833 19:53333693-53333715 CCTCCCCGCGGGTCCCGCCCAGG + Intergenic
1167995008 19:53395093-53395115 CCTCCTCGCGGGTCCCGCCCAGG + Intronic
1168703563 19:58455447-58455469 CCCCCAAGAGCAGCCGGCCCAGG + Exonic
925609392 2:5691542-5691564 CGCCCCCGCGCGCCCCGCCCCGG - Intergenic
926581435 2:14634961-14634983 CCGCCACGCGCGTCCGCCGCCGG + Exonic
927146871 2:20171933-20171955 CCCCCAAGAGGGTCTGGCCCAGG - Intergenic
928511788 2:32010120-32010142 GCCCCACGCCCGGCCGGCCGAGG - Intronic
933741720 2:85539107-85539129 CGCCCGCGCGCGCCCGGCTCGGG - Intergenic
934921125 2:98346424-98346446 CTCCCCCGCGCTCCCGGCCCAGG - Exonic
935273345 2:101454051-101454073 CCCCCACCCCCGACAGGCCCCGG + Intronic
935692570 2:105744747-105744769 CCGCCCCGCGCGCCCGGGCCTGG + Intergenic
937994014 2:127679658-127679680 CTCCCACGAGCGTTGGGCCCTGG - Intronic
939474957 2:142674991-142675013 CCCCCACCCCCGACAGGCCCCGG - Intergenic
941917797 2:170823547-170823569 GCCCCACGGGCGTCCTGCGCTGG - Intronic
942320245 2:174730180-174730202 CACCCACGCACGTCCAGCCGGGG - Intergenic
945649261 2:212538610-212538632 CCCCCACGCGCGCCCGGCTGGGG - Exonic
946340114 2:219061037-219061059 CCCCCTCGGGCGGGCGGCCCCGG + Intergenic
1170853711 20:20028325-20028347 CCCCCACCCCCGACAGGCCCTGG - Intronic
1173221862 20:41137879-41137901 CCCCCGCGCGGGGCGGGCCCAGG - Intronic
1176380521 21:6110418-6110440 CCCCGCCGCGCGGCCGGTCCCGG - Intergenic
1178992198 21:37366197-37366219 CCACCCCGCGCGCCCGGGCCTGG - Intronic
1179742951 21:43427822-43427844 CCCCGCCGCGCGGCCGGTCCCGG + Intergenic
1180161285 21:45999681-45999703 GCCCCACTTACGTCCGGCCCAGG - Exonic
1180163045 21:46006613-46006635 CCCCCACACAGCTCCGGCCCAGG + Intergenic
1182423633 22:30260483-30260505 CCCCCACGCTCGGCCTGCCCTGG - Intergenic
1184773984 22:46614200-46614222 CTGCCACGCGCGGCAGGCCCAGG - Intronic
1185317405 22:50185088-50185110 CCGCCGCGCCCGTCCTGCCCGGG - Intergenic
1185420272 22:50731043-50731065 CCCTCGCCCGCGTCCGGCCCCGG + Intergenic
949987806 3:9553628-9553650 GCCTCGCGCGCGTCCGGCCTGGG - Intronic
953032084 3:39185853-39185875 CCCCCAGGCTCCTCCCGCCCTGG + Exonic
954717384 3:52533474-52533496 CCCCGGCGCACGTCCCGCCCCGG + Intronic
955222253 3:57032802-57032824 CCCCCAGGAGAGTCCAGCCCGGG - Intronic
957405241 3:79767153-79767175 CCCCCACGCGCATCCATTCCTGG + Intronic
958111132 3:89147172-89147194 CCCCCACCCCCGACAGGCCCTGG - Intronic
966711823 3:182980175-182980197 CCCCCACCCGCGCCGGGCCCCGG + Intronic
966915853 3:184583774-184583796 CCCCTCCCCGCGTCCGCCCCGGG - Intronic
968643036 4:1724257-1724279 CCACCACGCCCGGCCGGCCTTGG + Intronic
968659973 4:1794814-1794836 CCCCCTCGCCCGTCCGGAGCCGG - Intronic
968729256 4:2261986-2262008 CGCCCGCGCCCGTCCGCCCCGGG + Exonic
968914983 4:3493423-3493445 CCCCCACGCGGGGCCACCCCCGG + Exonic
972396859 4:38664766-38664788 CCCCCGCCCGCGCCCTGCCCGGG - Intronic
974820230 4:67058123-67058145 CCCCCACCCGCCACAGGCCCTGG + Intergenic
975395525 4:73869594-73869616 ACCCCAGCCGCGTCCGGCCCGGG - Intronic
975409967 4:74038466-74038488 ACCCCAGCCGCGTCCGGCCCGGG + Intronic
975415355 4:74098975-74098997 ACCCCAGCCGCGTCCGGCCCGGG + Intronic
976076636 4:81306542-81306564 CCCCCACCCCCGACAGGCCCTGG + Intergenic
985629930 5:1008979-1009001 CCCCCGCGGGCTCCCGGCCCCGG + Exonic
985630022 5:1009280-1009302 AGCCCGCGCGCGTCCTGCCCTGG + Intronic
986402860 5:7396254-7396276 CCGCCGTGCGCGCCCGGCCCGGG - Exonic
987566860 5:19600188-19600210 CCCCCACCCACGACAGGCCCCGG - Intronic
989269105 5:39510994-39511016 CCTCCACCCCCGTCAGGCCCCGG - Intergenic
995976270 5:118039124-118039146 CCCCCACCCCCGACAGGCCCCGG - Intergenic
997319031 5:132963182-132963204 CCCCCACCCCCACCCGGCCCCGG + Intronic
998135352 5:139671493-139671515 CCGCCACCCGCGGCTGGCCCAGG - Intronic
1001342845 5:170862654-170862676 CCCGCGCCCGCGCCCGGCCCGGG - Intronic
1001891858 5:175345958-175345980 CCCCCACCCCCGACAGGCCCCGG - Intergenic
1002580535 5:180207584-180207606 CCCCCTCGCCAGTCCCGCCCTGG + Intronic
1002662761 5:180802813-180802835 CCCGCCCGGCCGTCCGGCCCCGG - Intronic
1003397096 6:5762916-5762938 CCCACAGGAGCGTCAGGCCCAGG + Intronic
1004262064 6:14117535-14117557 CGCCCCCGCGCGCCCGGGCCGGG - Intronic
1006671459 6:35732032-35732054 CCCCCGCGCGCATCCGGCGACGG - Intergenic
1011288280 6:85748416-85748438 CCCCCACCCCCGACAGGCCCTGG + Intergenic
1012347412 6:98207694-98207716 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1013602837 6:111721041-111721063 CCCCCACCCGCTTCGGGCCTTGG + Intronic
1016140160 6:140598527-140598549 CCCCCACGCCCAGCAGGCCCTGG - Intergenic
1017725823 6:157275194-157275216 CCGCCGCCCGCGCCCGGCCCCGG - Intergenic
1018727910 6:166627564-166627586 CCCCCACGCGGTTCCGCCCACGG + Intronic
1018932423 6:168250069-168250091 CCCCCACACCCGTCCCTCCCTGG - Intergenic
1019492840 7:1323170-1323192 CCTCCACGCGCCTCCCACCCGGG + Intergenic
1019525898 7:1480370-1480392 TCCCCACCCGAATCCGGCCCTGG + Exonic
1020287927 7:6699996-6700018 CCACCACGCCCGGCCGTCCCTGG - Intronic
1021716994 7:23469785-23469807 CACCCACGCGCGTGGGGGCCGGG - Intronic
1022112385 7:27239638-27239660 CACCCACCCCCCTCCGGCCCGGG + Intergenic
1023706358 7:42945797-42945819 CCCTCACCCGCCTCTGGCCCAGG - Intronic
1027839085 7:83284301-83284323 CCCCCAAGCCCCTCCTGCCCAGG + Intergenic
1028160118 7:87475738-87475760 CCCCCACGCGCGTCCGGCCCGGG + Exonic
1029813975 7:103075219-103075241 CCCCCGCGAGCCTCCTGCCCTGG + Exonic
1030973491 7:116090953-116090975 CCCCCACCCCCGACAGGCCCTGG - Intronic
1031268434 7:119612340-119612362 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1031778257 7:125928939-125928961 CCCCCACCCCCGACGGGCCCAGG - Intergenic
1033214283 7:139482805-139482827 CCCCCACACCCGCCCAGCCCTGG - Intronic
1036244179 8:7102524-7102546 CCCCCACCCCCGACGGGCCCCGG + Intergenic
1036897656 8:12648882-12648904 CCCCCACCCCCGACAGGCCCCGG - Intergenic
1037901236 8:22690796-22690818 GCCCCACGCGTGCCCGGCCGAGG - Exonic
1038807994 8:30812478-30812500 TCCCCACCCGCCCCCGGCCCCGG + Exonic
1039964118 8:42271476-42271498 CCCCCTCGTGGGTGCGGCCCGGG + Intronic
1041648806 8:60281218-60281240 CCCCCACGCGCGCTCCGCTCCGG - Exonic
1042578911 8:70254682-70254704 CCCCCACCCCCGCCCGCCCCTGG - Intronic
1045488623 8:102654215-102654237 CCCCCGCCCGCGCCCGACCCGGG + Intronic
1045535236 8:103021294-103021316 CACCCACCCGCGTCCCTCCCAGG - Intronic
1049030931 8:140036999-140037021 CCCCCACCCCCGACAGGCCCTGG + Intronic
1049145883 8:141000952-141000974 CCCTCCCGCGCCCCCGGCCCGGG - Intronic
1049396461 8:142403238-142403260 TCCCCGCGCGCGTCCGGGACCGG - Intronic
1049551552 8:143262133-143262155 CTCCCACGCCCGTCTTGCCCTGG + Intronic
1049761445 8:144333712-144333734 CCCCCGCGCGCGTGCCGCCCCGG + Exonic
1055208975 9:73766198-73766220 CCCCCACCCCCGACTGGCCCTGG - Intergenic
1058105545 9:100967081-100967103 CCCCCACCCCCGACAGGCCCTGG + Intergenic
1058412388 9:104747950-104747972 CCGCCACGCGCGCCCAGACCTGG + Intronic
1058507966 9:105685919-105685941 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1060268492 9:122125952-122125974 CCCCCAGGCTGGTCAGGCCCGGG + Intergenic
1060979780 9:127785599-127785621 CCCCCTCGCCCGGCCGCCCCGGG + Intergenic
1061350593 9:130061654-130061676 CCACCACGCCCGGCCTGCCCTGG - Intronic
1061365972 9:130172616-130172638 GCCCCAACCGGGTCCGGCCCGGG + Exonic
1062022617 9:134326552-134326574 GCCCCCGGCGCGGCCGGCCCGGG - Intronic
1062323334 9:136001133-136001155 CCTCCAAGCTCGTCCGACCCAGG + Intergenic
1062547466 9:137070128-137070150 ACCCCACGCGCGCCCCGGCCCGG - Exonic
1062571599 9:137188353-137188375 CCCCAAAGCGCGTACGGTCCCGG + Intronic
1187507287 X:19887795-19887817 CCCCGACGCGGCCCCGGCCCCGG - Intergenic
1187731594 X:22260704-22260726 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1192963695 X:76155440-76155462 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1193013016 X:76698399-76698421 CCCCCACCCCCGACAGGCCCCGG - Intergenic
1193579529 X:83247171-83247193 CCCCCACTCACGACAGGCCCCGG - Intergenic
1193658704 X:84230043-84230065 CCCCCACCCCCGACAGGCCCCGG - Intergenic
1193811168 X:86053689-86053711 CCCCCACCCACGACAGGCCCTGG + Intergenic
1194190720 X:90834040-90834062 CCCCCACCCCCGACAGGCCCCGG + Intergenic
1195008205 X:100708062-100708084 CCCCCACCCCCGACAGGCCCCGG - Intronic
1195060776 X:101191713-101191735 CACCCCCGCCCGGCCGGCCCAGG + Intergenic
1195963184 X:110406260-110406282 CCCCCACGCCCCACAGGCCCCGG + Intronic
1197602114 X:128543272-128543294 CCCCCTAGCGGCTCCGGCCCCGG + Intergenic
1199021596 X:142884706-142884728 CCCCCACCCCCGACAGGCCCTGG - Intergenic
1200599746 Y:5191144-5191166 CCCCCACCCCCGACAGGCCCCGG - Intronic
1201370957 Y:13263932-13263954 CCCCCACTCCCGACAGGCCCTGG + Intronic