ID: 1028167600

View in Genome Browser
Species Human (GRCh38)
Location 7:87556492-87556514
Sequence ATGTAGAAGCAGAGAAGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 793
Summary {0: 1, 1: 0, 2: 3, 3: 69, 4: 720}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028167595_1028167600 27 Left 1028167595 7:87556442-87556464 CCTGCACTGCTAATTTGAAGAGA 0: 1
1: 0
2: 1
3: 11
4: 137
Right 1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 720
1028167594_1028167600 30 Left 1028167594 7:87556439-87556461 CCTCCTGCACTGCTAATTTGAAG 0: 1
1: 0
2: 0
3: 15
4: 124
Right 1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 720
1028167596_1028167600 1 Left 1028167596 7:87556468-87556490 CCAGATTAAGACCTCAATTACTT 0: 1
1: 0
2: 0
3: 2
4: 135
Right 1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 720
1028167597_1028167600 -10 Left 1028167597 7:87556479-87556501 CCTCAATTACTTTATGTAGAAGC 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG 0: 1
1: 0
2: 3
3: 69
4: 720

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028167600 Original CRISPR ATGTAGAAGCAGAGAAGGGA AGG Intronic
900410080 1:2508434-2508456 GTCTAGAAGCAGCGCAGGGAAGG + Intergenic
900476761 1:2879723-2879745 ATGGAGAAGCAGACACGCGAGGG + Intergenic
900500238 1:3000908-3000930 ATGGTGAAGCAGAGTAGGGGAGG + Intergenic
900558857 1:3293795-3293817 ATGGAGAAGCCGACAAAGGATGG - Intronic
900704369 1:4070702-4070724 ATGTAGAATCAGAGAGAGGAAGG + Intergenic
900822360 1:4899394-4899416 ATCTACAAGCTAAGAAGGGAGGG - Intergenic
900870901 1:5302072-5302094 AGAAAGAAGTAGAGAAGGGAAGG + Intergenic
901725414 1:11238097-11238119 AGGTAGAAGCTGGGAAGGGCTGG - Intronic
902200644 1:14830973-14830995 ATGAAGAGGTAGAGAAGGGCTGG - Intronic
902996401 1:20228835-20228857 ATGGAGATGCAGAGAAGTTAAGG - Intergenic
903254914 1:22090043-22090065 AAGCAGCAGCAAAGAAGGGAAGG - Intronic
904270700 1:29348118-29348140 AGGCAGGAGCAGAGAAGGCAGGG - Intergenic
904575951 1:31505237-31505259 AGGTACAACCAGAGAAGGGAGGG - Intergenic
904662343 1:32094708-32094730 AGGTAGAATCAGGGAAGGAAAGG + Intronic
905407339 1:37743391-37743413 ATGGAGAAACTGAGAAGGGCTGG + Intronic
905518242 1:38578009-38578031 ATCTAGGAGAATAGAAGGGAAGG - Intergenic
905684400 1:39898508-39898530 CTGAAGATTCAGAGAAGGGAGGG + Intronic
907401421 1:54227166-54227188 AAGGAGAAGCAGAGAAGGGGGGG + Intronic
907509489 1:54947580-54947602 ATTGAGATGCAGAGAGGGGAAGG + Intergenic
907877102 1:58501707-58501729 ATGTGTGAGCAGAGATGGGAGGG - Intronic
908325605 1:63020523-63020545 GTGTAGAAGCAGAGAACAGAGGG + Intergenic
908447917 1:64219397-64219419 ATGTGGAGGCAGGGAAGGGGAGG - Intronic
908615301 1:65914123-65914145 ATGTGAAAGGAAAGAAGGGAGGG + Intronic
909196758 1:72636467-72636489 AAGTAAAAACAAAGAAGGGAGGG - Intergenic
909245354 1:73274146-73274168 CTGTAGGAGCAGAGGTGGGAAGG + Intergenic
909680758 1:78288761-78288783 TAGTTGAGGCAGAGAAGGGAAGG - Intergenic
910174421 1:84413630-84413652 ATGTAGAATGAGATAAGGAAGGG - Intronic
910434873 1:87196053-87196075 AGGTAGAAGCAGAGTAGAGCTGG - Intergenic
911309073 1:96270268-96270290 ATTTGGTAGGAGAGAAGGGAAGG - Intergenic
912710747 1:111948189-111948211 CTGTAGAGGCAGAGCAGAGAGGG - Intronic
912753634 1:112306210-112306232 AGATAGAAGCAAAGAAGGCAGGG + Intergenic
913182724 1:116337712-116337734 CCCTAGAAGCAGAAAAGGGAAGG - Intergenic
914948533 1:152088727-152088749 ATGTAGAAGCATTTAAAGGATGG - Intronic
915040562 1:152964996-152965018 AGGTAGAAGAAGAGAAGGGAAGG + Intergenic
916255641 1:162785058-162785080 ATTTAGAAGCAGTGTAGGCAGGG - Exonic
916463255 1:165048083-165048105 AGGAAGAAGGGGAGAAGGGACGG + Intergenic
916592176 1:166203016-166203038 AAATAAAAGCAGAGATGGGAAGG - Intergenic
916917660 1:169427256-169427278 ATATAGAGGGAGAGAAGGGAAGG - Intronic
917442212 1:175078013-175078035 ATCTGGAAGCTGAGCAGGGAGGG + Intronic
917560677 1:176151584-176151606 ATTTAGTTGCAGAGAAGGGTAGG - Intronic
918083776 1:181227988-181228010 ATGAAGAAGGAGAAATGGGATGG - Intergenic
918339063 1:183552248-183552270 AAGTGAAAGCTGAGAAGGGAAGG + Intronic
918638856 1:186813757-186813779 ATGTTGTAGCAAAGAAGGAAAGG - Intergenic
919496791 1:198282704-198282726 ATGAAGATGCAGAGAAAGAAAGG + Intronic
920072992 1:203316555-203316577 ATGGAGAAGCTAAGAAGGGCAGG + Intergenic
920113776 1:203605185-203605207 ATGCAGGAGCAGAGAAGGCAGGG - Intergenic
920258293 1:204671599-204671621 ATCTGGACTCAGAGAAGGGAAGG + Intronic
920696283 1:208183487-208183509 ATGAAGGGGCAGAGATGGGAGGG + Intronic
920765407 1:208827985-208828007 TTGAAGAAGCAGACAAGGCAGGG + Intergenic
921031315 1:211337434-211337456 ATGGAGAGGCAGAGAAACGAAGG + Intronic
922825836 1:228517866-228517888 AAGGAGAAGGAGATAAGGGAAGG - Intergenic
923293285 1:232568241-232568263 ATGAAGCAGCAGAGAAAGGAAGG + Intergenic
923357632 1:233176339-233176361 AGGAAGAAGGAGAGAAAGGAAGG - Intronic
923566502 1:235080387-235080409 ATGAAGAAAGAGAGAAAGGAAGG + Intergenic
924147705 1:241094106-241094128 AAGGAGAAGCAGAGAAGATAAGG - Intronic
924421816 1:243917074-243917096 ATGGAAAAGGAGAGAAGGGCGGG + Intergenic
924878723 1:248134728-248134750 ATGTTGAAGCATAGTAAGGAAGG + Intergenic
1062952748 10:1516946-1516968 CTGAAGTAGCAGAAAAGGGATGG + Intronic
1063016904 10:2087502-2087524 ATGGAGAAGGAGAGAAGGAAGGG + Intergenic
1064328471 10:14372581-14372603 ATGGAGGAGCAGCGAAGGGCTGG - Intronic
1064473202 10:15658452-15658474 ATGTAGGAGCTGAGGACGGAGGG - Intronic
1064499255 10:15951234-15951256 ATCCAGAAGCTGAGAAGGGTTGG - Intergenic
1064906081 10:20347544-20347566 AGGCAGAAGCAGAGAGGAGAGGG - Intergenic
1065201651 10:23318184-23318206 TAGTAGAAGCACAGCAGGGATGG + Exonic
1065320415 10:24503799-24503821 AGGCAGGAGCAGTGAAGGGAAGG - Intronic
1065643093 10:27805143-27805165 AAGTGCAAGAAGAGAAGGGAAGG + Intergenic
1065905596 10:30248442-30248464 AAGAAGAAGAAGAGAAGGGAAGG + Intergenic
1066159257 10:32710980-32711002 ATGTATCAGCATAGATGGGAGGG + Intronic
1066467050 10:35661416-35661438 AGGAAGAAGCAGAGGAGAGACGG - Intergenic
1066473402 10:35721530-35721552 ATGTAGAAGTAGAAAATGAAAGG + Intergenic
1066693773 10:38060273-38060295 CTGTGGAAGCAGAGTGGGGATGG - Intronic
1066809555 10:39310378-39310400 TTGTAGAATCTGTGAAGGGATGG - Intergenic
1066999044 10:42588869-42588891 CTGTGGAAGCAGAGTGGGGATGG + Intronic
1067354912 10:45515211-45515233 AACTTGAACCAGAGAAGGGAAGG + Intronic
1067752250 10:48979337-48979359 AAGTGGAAGCAGATATGGGAGGG - Intronic
1067807962 10:49406111-49406133 ATGCAGAAGGGGTGAAGGGAAGG + Intergenic
1068935935 10:62635847-62635869 AGGTAGAATCTGAGCAGGGAGGG + Intronic
1069249308 10:66247209-66247231 AAGAAGAAGTAGAGAATGGAAGG + Intronic
1069357776 10:67607470-67607492 ATGAAGAAGAAGAGGAGGGTTGG + Intronic
1070552113 10:77498108-77498130 ATGCAGAAAAAGAGAAGGCAGGG + Intronic
1070902931 10:80046718-80046740 ATGTAGAAGAAGGAAGGGGAAGG + Intergenic
1070972463 10:80578849-80578871 ACGAGGAAGGAGAGAAGGGATGG + Intronic
1071204306 10:83255620-83255642 TCCTAGAACCAGAGAAGGGAAGG + Intergenic
1071375938 10:85003386-85003408 ATGCAGAACCAAAGAAGTGAGGG + Intergenic
1071822331 10:89291214-89291236 ATGAGGAAGAAGAGAATGGAGGG - Intronic
1071888043 10:89972034-89972056 ATGGAGAAGTAGAGATGGGGAGG + Intergenic
1072767154 10:98104420-98104442 ATGAAAAAGAAAAGAAGGGAGGG - Intergenic
1073069042 10:100781849-100781871 ATGGAGAAGAAGAGGAGAGAGGG - Intronic
1073431414 10:103489915-103489937 GGGAAGAAGCAGAGAAGGAAGGG + Intergenic
1073485532 10:103815957-103815979 ATATAGAAGCAGAGAAGAGAAGG + Intronic
1073568439 10:104555576-104555598 AGGGAGAAGGAGAGAAGGGATGG + Intergenic
1073992436 10:109277584-109277606 AAGTGGAAGCAGTGGAGGGAAGG - Intergenic
1074308583 10:112301533-112301555 TTGTGGTAGCAGAGATGGGATGG + Intronic
1074371313 10:112902926-112902948 AAGAAGAAGGAAAGAAGGGAAGG - Intergenic
1074426352 10:113354803-113354825 AGGGGAAAGCAGAGAAGGGAAGG + Intergenic
1074609205 10:115004639-115004661 ATGAGGAAGGAAAGAAGGGAAGG - Intergenic
1074775834 10:116767502-116767524 TAGTGGGAGCAGAGAAGGGAGGG - Intergenic
1074851479 10:117442824-117442846 ATCCAGAAGCACAGAAGGGCTGG - Intergenic
1074874265 10:117602173-117602195 AAGTAGATGGAGAAAAGGGAAGG + Intergenic
1075211386 10:120494090-120494112 TTGTGAAAGCAGAGTAGGGAGGG + Intronic
1075244693 10:120810680-120810702 AGGAAGAAGGAAAGAAGGGAGGG + Intergenic
1075924998 10:126244409-126244431 CTGGAGCAGCAGAGAAGGGAGGG + Intronic
1076422448 10:130340902-130340924 ATGTAGAAGCAGAGGGCGGTGGG - Intergenic
1078125741 11:8561144-8561166 ATGAAGAAGCAGAGATAGGAAGG - Intronic
1078630198 11:12995648-12995670 AGTGAGAAGCAGAGAAGGAAAGG + Intergenic
1079181047 11:18193799-18193821 ATGAAGAAGAAGAGGAGAGAGGG + Intronic
1079579693 11:22048297-22048319 TTCTAGAAGCAGAGAAGTGGTGG + Intergenic
1080683355 11:34496060-34496082 GGGTGGAAGCAGAGAGGGGAGGG - Intronic
1081527144 11:43934971-43934993 AGATGGAAGCAGAGAGGGGAGGG - Intronic
1082193893 11:49278664-49278686 AAGAAGGGGCAGAGAAGGGAAGG + Intergenic
1082974663 11:59059817-59059839 ATGTAAAAGCTTAGATGGGACGG - Intergenic
1082979083 11:59103609-59103631 ATGTAAAAGCTTAGATGGGATGG - Intergenic
1082987953 11:59184118-59184140 ATTTGGGAGCAGAGAATGGATGG + Intronic
1084179839 11:67440766-67440788 ATGCAGAAGCAGAGAGGGCTGGG + Intronic
1084665607 11:70574612-70574634 ATGCAGAGTCAGAGAAGGGGAGG - Intronic
1084759196 11:71257702-71257724 AGAGAGAAGGAGAGAAGGGAAGG + Intergenic
1085016575 11:73177867-73177889 ATGCAGACTCGGAGAAGGGAAGG + Intergenic
1085101012 11:73799946-73799968 GTGTGGAAGAATAGAAGGGATGG + Intronic
1085127262 11:74010354-74010376 GAGAAGAAGAAGAGAAGGGAGGG + Intergenic
1085514316 11:77103473-77103495 AGGGAGAAGCAGAGGAGGAAAGG - Intronic
1085690983 11:78663531-78663553 AGGTAGCAAGAGAGAAGGGAGGG - Intronic
1085847906 11:80086803-80086825 ATCTAGAATAAGGGAAGGGATGG - Intergenic
1086450192 11:86907911-86907933 TTGTAGGAGCAGAGAATAGATGG - Intronic
1086672252 11:89562395-89562417 AAGAAGGGGCAGAGAAGGGAAGG - Intergenic
1087641971 11:100764677-100764699 ATGTGAAAGGAAAGAAGGGAGGG + Intronic
1088454825 11:110022600-110022622 AAGTAGATGCTGAGAAGAGATGG - Intergenic
1089116222 11:116097179-116097201 AGGAAGGAGCTGAGAAGGGAAGG + Intergenic
1089172123 11:116519620-116519642 AAGTAGAAACAGAGAAGGTGAGG + Intergenic
1089346219 11:117793416-117793438 TTGTAGATGAAGAGAGGGGAGGG - Intronic
1089579983 11:119475604-119475626 CTGTGGTAGCACAGAAGGGAGGG - Intergenic
1089712569 11:120325997-120326019 CTTTAGAAGGAGATAAGGGAGGG + Intronic
1090351913 11:126113282-126113304 GGGAAGAGGCAGAGAAGGGAGGG + Intergenic
1090406240 11:126477278-126477300 AGGTAGGGGCAGAGCAGGGAGGG - Intronic
1090599811 11:128358562-128358584 ATGTAGATGCAGGGAGAGGATGG - Intergenic
1091193051 11:133710292-133710314 AGGAAGAAACTGAGAAGGGATGG - Intergenic
1091517937 12:1204379-1204401 ATGCAGGATTAGAGAAGGGAAGG - Intronic
1093195461 12:16125086-16125108 AGAAAGAAGGAGAGAAGGGAGGG - Intergenic
1093431063 12:19085360-19085382 ATGTCAGAGCAGAGAAGGCAAGG - Intergenic
1094077090 12:26489303-26489325 TGGAAGAGGCAGAGAAGGGAAGG + Intronic
1094282111 12:28751832-28751854 ATGGAGAAGAAAAGAAGGGAAGG - Intergenic
1094427365 12:30328818-30328840 ATGAAGTAGCAGACAAGTGAAGG - Intergenic
1094799613 12:34018161-34018183 ATGAAGAATCAGAGAAGCCAGGG + Intergenic
1095821308 12:46481559-46481581 ATTTTTAAGCAGAGAAGTGATGG + Intergenic
1096745018 12:53721176-53721198 ATTTGGAAGAAGAGAATGGATGG - Intronic
1097026199 12:56057492-56057514 CTCTAGAAGCTGAAAAGGGAAGG - Intergenic
1097395067 12:59063442-59063464 ATTAAGAAGCAGAGATGGGGAGG + Intergenic
1097507498 12:60494290-60494312 ATGGAGAAGCAGAGGAAGCAGGG + Intergenic
1097583868 12:61491957-61491979 ATTTAGAAGAACAGAAGGGAAGG + Intergenic
1098341939 12:69460680-69460702 ATGAAGGAGAAGAGAAAGGATGG + Intergenic
1098901572 12:76116728-76116750 ATGTAGAAGAAAAGAAAGAAAGG - Intergenic
1098977130 12:76914156-76914178 ATTTGGAAGGAAAGAAGGGATGG - Intergenic
1099507410 12:83496577-83496599 AAGTAGAATCAGAGAATAGATGG - Intergenic
1100039373 12:90295306-90295328 CTTTAGAAGCAGACAATGGAAGG - Intergenic
1100242425 12:92722940-92722962 AGGTAGGAGTAGGGAAGGGAAGG + Intronic
1100446563 12:94666001-94666023 ATGGAGAAGCAGGGAAAGGCTGG - Intergenic
1101486718 12:105171501-105171523 AGGTAGATGCAGACAAGGTAAGG + Intergenic
1101580449 12:106037565-106037587 AGGTAAAGGAAGAGAAGGGAAGG - Intergenic
1102194730 12:111016931-111016953 AGAGAGAAGAAGAGAAGGGAGGG - Intergenic
1102375960 12:112421043-112421065 ATTTAGAAGCATAGAAGTGTGGG + Intronic
1102573594 12:113842471-113842493 ATGTGGAACCAGAGAAATGAAGG - Intronic
1102868604 12:116394334-116394356 AGACAGAAGCAGAGATGGGAGGG - Intergenic
1103862485 12:124025938-124025960 TTGGAGAAGCAGGGAAGGGATGG + Intronic
1103936747 12:124481176-124481198 GTGTAGAAGGAGAGAAGGAAGGG + Intronic
1104190792 12:126480137-126480159 ATGGAGAAGAGGAGAAGGGGAGG + Intergenic
1104641516 12:130470214-130470236 TTGTAGGATCAGAGAAAGGAGGG - Intronic
1104654512 12:130563941-130563963 ATGTAGCAGCAGAGGAGGCTGGG - Intronic
1104915892 12:132264357-132264379 ATGAAGAAGCCGAGCCGGGATGG + Intronic
1105046518 12:133008361-133008383 ATGTGGGAGCAGAGAAGGGGAGG - Intronic
1105760805 13:23512616-23512638 CTGCAGATGCAGAGAAGAGAAGG - Intergenic
1106740796 13:32638830-32638852 ATGGGGAAGGAGGGAAGGGAGGG + Intronic
1106854554 13:33835382-33835404 ATGCTGAAGAAAAGAAGGGAGGG + Intronic
1106947031 13:34840149-34840171 AGGAAGAAGAAGAGAAGGGAAGG + Intergenic
1107100775 13:36588602-36588624 TGCTAGAAGCAGAGGAGGGAAGG + Intergenic
1107320931 13:39187579-39187601 ATTTAGAAGCAAAATAGGGAAGG - Intergenic
1107350954 13:39514250-39514272 ATTAACAAGCAGAGAAGGGCGGG + Intronic
1107691530 13:42958164-42958186 ATGAGGAATCAGAGAAGGAAAGG + Intronic
1108148999 13:47511883-47511905 AAGCAAATGCAGAGAAGGGATGG - Intergenic
1108360783 13:49666333-49666355 ATGTGGAAGCAGAGTGGGGAGGG + Intronic
1108596145 13:51951342-51951364 ATGGAGAAGCAGCTAAGGGAGGG + Intronic
1108793280 13:53999049-53999071 ATATAAAAGCAGAGTTGGGAGGG - Intergenic
1108982174 13:56528803-56528825 ATAAGGAAACAGAGAAGGGAAGG + Intergenic
1109214318 13:59570554-59570576 AGGAAGAAGGAGAGAAGGGATGG + Intergenic
1109711669 13:66168639-66168661 CTTTAGAAGCAGAAAAGGAAAGG - Intergenic
1109932839 13:69238475-69238497 ATGGAGAAGCACAGAAGGGCAGG - Intergenic
1110375058 13:74783897-74783919 ATGTGGAGGCAGGGAAGGGAGGG + Intergenic
1110558899 13:76888759-76888781 CTGAAGAAGGTGAGAAGGGAGGG - Intergenic
1110689503 13:78415806-78415828 ATATGGAAGTAGAGAATGGAAGG + Intergenic
1110719299 13:78743694-78743716 ATGTGGGAGGTGAGAAGGGAGGG + Intergenic
1111180363 13:84655241-84655263 TTGTAGAAGCACATACGGGATGG + Intergenic
1111388739 13:87562923-87562945 ATGTAGAAGTAGAAGAGAGAAGG + Intergenic
1111684915 13:91489864-91489886 AATTAGAAGCATAGATGGGAAGG + Intronic
1112521219 13:100097095-100097117 ATGTACAAACAGGGAAAGGAAGG + Intronic
1113659351 13:112094986-112095008 AAGAAGAACAAGAGAAGGGAAGG - Intergenic
1113990408 14:16023808-16023830 AGCAAGAAACAGAGAAGGGAAGG - Intergenic
1114401749 14:22416486-22416508 ATGTAGAGGCAGAGAAAAGCTGG - Intergenic
1114652205 14:24292384-24292406 CAGTAGAAGCAGAGAGGGCAGGG - Intronic
1114895802 14:26989607-26989629 GTGTAGAACCAGACAAGGGTGGG + Intergenic
1115315596 14:32021609-32021631 AGCTAGAACCAGAGAAGGCAGGG + Intergenic
1116636471 14:47402601-47402623 ATGTAAAAGAAGAAAAGAGAAGG + Intronic
1117026497 14:51625722-51625744 TTGGATAAGCAGAGAAGAGAGGG - Intronic
1118489956 14:66249309-66249331 AGGGAGAAGAAGAGAAAGGAAGG - Intergenic
1118653200 14:67919796-67919818 ATCTAGCAGCAGAGAACTGAAGG - Intronic
1118752594 14:68817609-68817631 CTGTAGAAGCAGAGACTGGTAGG + Intergenic
1119484150 14:74977482-74977504 TGGAGGAAGCAGAGAAGGGAAGG - Intergenic
1119867940 14:77989724-77989746 ACAGAGAGGCAGAGAAGGGAGGG - Intergenic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1120360644 14:83497414-83497436 ATCTGGAAGCAGAAAAGTGAAGG - Intergenic
1120524706 14:85564157-85564179 ATGTACAGGCAGAGAAGAGCAGG - Intronic
1121059715 14:90895534-90895556 GTGGAGAAGAAGAGAAAGGATGG - Intronic
1121489818 14:94349766-94349788 ACAGAGAAGCTGAGAAGGGAAGG + Intergenic
1121639419 14:95475305-95475327 AGGCAGAAGCAGAGAAGGGGTGG + Intronic
1121777899 14:96602881-96602903 ATGTAGAAACAGCCCAGGGAAGG + Intergenic
1121782619 14:96631681-96631703 ATGTAAAAGCAGAAAGGTGATGG - Intergenic
1122685066 14:103500120-103500142 ATGTAGAAGCAGAGAGAAGAGGG - Intronic
1122889919 14:104727495-104727517 ATGTGGCCGCAGAGCAGGGAGGG - Intronic
1124153338 15:27202076-27202098 AGATAGAAGCAGAGAGGAGATGG - Intronic
1124347430 15:28932018-28932040 ATGCAGCAGCACAGAAAGGAGGG - Intronic
1125236502 15:37520271-37520293 ATGTAAAAAGAGAGCAGGGAAGG + Intergenic
1126727467 15:51646869-51646891 AAGTAATAGAAGAGAAGGGAAGG + Intergenic
1127512123 15:59653199-59653221 ATTTAGAAACAGATGAGGGATGG + Intronic
1127981371 15:64037731-64037753 ATGGAGGCTCAGAGAAGGGAAGG - Intronic
1127983153 15:64048729-64048751 ATGTGCATGCAGAGGAGGGAAGG - Intronic
1128705033 15:69832331-69832353 AAGAAGAAGCGGGGAAGGGAAGG + Intergenic
1128760455 15:70213105-70213127 ATGTAAAAGAAGAGGTGGGAGGG + Intergenic
1128935634 15:71744110-71744132 AGGTGGCAGCAGAGAAAGGAAGG + Intronic
1129432107 15:75506839-75506861 ATGAAGAGGCAGAGGAGGAAAGG - Intronic
1130285500 15:82551098-82551120 ATAAAGAAGCAGAGAAGGTAGGG + Intronic
1131068758 15:89450855-89450877 ACGTAGAGGGAGAGAAGGGAAGG + Intergenic
1131357434 15:91757912-91757934 AGGAAGAAGCAAAGAGGGGAGGG - Intergenic
1131538655 15:93257980-93258002 ATGTAGGAGAAGTGTAGGGAAGG + Intergenic
1131961497 15:97794103-97794125 TTGTAGAGGCAAAGAAAGGAGGG - Intergenic
1132094065 15:98969171-98969193 ATCTAGGAGAAGAGATGGGAAGG - Intronic
1132612256 16:823001-823023 ATGTAGACACAGAAAAGTGATGG + Intergenic
1132756186 16:1486578-1486600 AACTAGAAACAGAGGAGGGAGGG + Exonic
1133643742 16:7743450-7743472 ATGTAAAATAAGATAAGGGAGGG - Intergenic
1133725966 16:8537882-8537904 ATGTATAAGCATAAAAGGCAAGG + Intergenic
1133846316 16:9457219-9457241 AAGGAGTAGCAGGGAAGGGATGG + Intergenic
1133876917 16:9743704-9743726 ATGTAGAAGAAGATGAGAGATGG + Intergenic
1133908239 16:10040967-10040989 AGGTGGAGGCAGAGAAGGAAGGG - Intronic
1134281403 16:12820114-12820136 ATGAAGAAGAAATGAAGGGAGGG + Intergenic
1134349184 16:13420603-13420625 ATTTCAAAGCACAGAAGGGAGGG + Intergenic
1135014290 16:18911211-18911233 ATGTAGAAGGAGGGCAGGCATGG + Intronic
1135187171 16:20325099-20325121 ATGAAGAGGCAGAGAAGTGAAGG + Intronic
1136331454 16:29580509-29580531 ATGTAGAAAGAGAGCAGGCACGG + Intergenic
1137368714 16:47884496-47884518 ATGATGATGCAGAGAAGGCAAGG - Intergenic
1137433054 16:48433908-48433930 GTGTAGAGGGAGAGAAGGGAAGG - Intronic
1137639254 16:50013928-50013950 ATGGTGAAGCAGGGGAGGGAAGG - Intergenic
1137756887 16:50909405-50909427 ATGAGGAAGCAGAGAAGAGAAGG - Intergenic
1138460117 16:57143098-57143120 CTGTAGATGGAGAGAACGGAGGG - Intronic
1138785492 16:59840885-59840907 GTGTGGATGCAGACAAGGGAAGG + Intergenic
1139313794 16:66050502-66050524 TTGTAGAACCAGAGAAAGGATGG + Intergenic
1139364471 16:66425516-66425538 ATGAAGGATCAGAGAAAGGAGGG - Intergenic
1139597644 16:67967757-67967779 ATTAGGAAGCAGTGAAGGGAGGG - Intronic
1139656311 16:68389174-68389196 CAGTAGGAGCAGAGCAGGGAGGG + Intronic
1139813826 16:69649406-69649428 AAGTAGAAGCAGAAAAATGAAGG - Intronic
1139927162 16:70495842-70495864 ATGTACTAGCAGAGCAGTGATGG + Intronic
1140578674 16:76202839-76202861 ATGTAGATGCTAAGAAGGCAAGG + Intergenic
1140746439 16:77984614-77984636 ATGAAGATGCAAAGTAGGGAGGG + Intergenic
1141458866 16:84164395-84164417 ATGAAGAAGCAGAGCACAGAGGG - Intronic
1141662302 16:85448007-85448029 AGGGAGAAGCAGAGCTGGGAAGG + Intergenic
1143114731 17:4576119-4576141 ATGATGAAGAGGAGAAGGGAGGG - Intergenic
1143174138 17:4947175-4947197 AAGCAGAAGCGGAGAGGGGAAGG + Intronic
1143212338 17:5197710-5197732 TTGTGGAAGTAGAGAAGGAAGGG - Intergenic
1143349315 17:6275846-6275868 ATCTACAGGCAGACAAGGGATGG + Intergenic
1143731322 17:8884542-8884564 TGAGAGAAGCAGAGAAGGGAAGG - Intronic
1143818632 17:9541293-9541315 ATGTGGAAGAGGAGAATGGAGGG + Intronic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144262610 17:13537405-13537427 ATGGAGGAGCTGAGAAAGGAAGG - Intronic
1144810042 17:17993187-17993209 ATGAAGAAGCTGAGGAGGGCTGG + Intronic
1146516826 17:33495953-33495975 GTGAAGACTCAGAGAAGGGAAGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146672798 17:34753484-34753506 AAGGAGAAGCAGAGAAGGAGGGG - Intergenic
1147132370 17:38417117-38417139 ATGTAGAAGAAGAGAAGCACTGG + Intergenic
1147159068 17:38560202-38560224 ATGGAGTCCCAGAGAAGGGAAGG + Intronic
1147212146 17:38877886-38877908 ATGAGGAAGGAGAGAGGGGAGGG + Intronic
1147242776 17:39101484-39101506 ACGGAGAAGAAGGGAAGGGAGGG + Intronic
1147337417 17:39735951-39735973 AAGTAGAAGCACAGAGGAGAGGG - Intergenic
1147402190 17:40187500-40187522 ATGTAGGAGATGAGATGGGAAGG - Intronic
1147530215 17:41269257-41269279 ATTAAGAAGCAAAGAAAGGAGGG + Intergenic
1148682730 17:49484025-49484047 ATGGAGAAGAAGAGAGAGGAAGG - Intergenic
1149272418 17:54994732-54994754 ATGGAGAGGCAGAGAAGGACAGG - Intronic
1149533552 17:57414920-57414942 GGGTAGACACAGAGAAGGGAAGG + Intronic
1149543948 17:57489315-57489337 ATGTAGCAGCTGGGGAGGGATGG + Intronic
1149594413 17:57855780-57855802 ATGCACAGGCAGTGAAGGGAAGG - Intergenic
1149808923 17:59647810-59647832 AGGAAGGAGAAGAGAAGGGATGG - Intronic
1150218445 17:63482911-63482933 AGGGAGATGCAGAGAAGGTATGG - Intergenic
1150319444 17:64199888-64199910 ATGCACAAGAAGAGAAAGGAAGG - Intronic
1150587072 17:66528507-66528529 ATGCAGAAGCAGAGTTGGGAGGG + Intronic
1150854707 17:68740917-68740939 ACAGAGAAGCAGAGAAGAGAAGG + Intergenic
1151754542 17:76065889-76065911 ATATAGAAGGAGAGGAGGCATGG - Intronic
1153177051 18:2387820-2387842 ATGAAGAAGCAGAAAAAAGAAGG + Intergenic
1153187716 18:2503209-2503231 ATGTTGAGGCAGAGAAGGATGGG - Intergenic
1153432620 18:5035201-5035223 ATCTAAAAGAAGAGGAGGGAGGG + Intergenic
1153498073 18:5720720-5720742 ATGGAGAGGAAGAGAAGAGAAGG + Intergenic
1153738435 18:8097352-8097374 AGGTAGAAGTAGAGATGAGATGG - Intronic
1154095772 18:11413728-11413750 AGGAAGGAGAAGAGAAGGGAAGG - Intergenic
1154253036 18:12759892-12759914 TCGTAGAAAGAGAGAAGGGAAGG - Intergenic
1154465825 18:14642159-14642181 ATGTAGAAGGAGGAAAGAGAGGG - Intergenic
1155517571 18:26638935-26638957 ATGGAGAGGCAAAGAAGGAACGG - Intronic
1155705695 18:28808870-28808892 ATGTGGAAGGAGAGAAGAGAAGG - Intergenic
1156149869 18:34228365-34228387 AGGTAGAGGGAGAGAAGTGATGG + Intergenic
1156277545 18:35598042-35598064 TTGAAAAAGAAGAGAAGGGAGGG - Intronic
1156392698 18:36665744-36665766 GTGAAGAAGCAGAGAGGAGATGG + Intronic
1156606401 18:38672029-38672051 ATGCTGAAGGAGAGAAGGCAGGG - Intergenic
1157168807 18:45383603-45383625 AGGGAGAAGTAGAGAAGGGAAGG - Intronic
1157423820 18:47568274-47568296 ATTGGGAAGCAGAGAGGGGATGG + Intergenic
1157690091 18:49674476-49674498 AGGCAGAAGGAAAGAAGGGAGGG + Intergenic
1158224555 18:55187097-55187119 TTCAAGAAGCTGAGAAGGGATGG + Intergenic
1158355051 18:56608698-56608720 ATGCAGAAGCAGATATGAGAAGG + Intronic
1158450681 18:57561732-57561754 ATGTGGTAGCAGGGAATGGAGGG - Intronic
1158669262 18:59460234-59460256 ATCCAGGAGGAGAGAAGGGAGGG - Intronic
1158813740 18:61069315-61069337 ATGCAGAAGCAGAGTATGGAAGG - Intergenic
1158898878 18:61942349-61942371 AGGTGGGAGAAGAGAAGGGAGGG - Intergenic
1159283116 18:66312332-66312354 AGGAAGAAGAAGAGAAGGAAGGG + Intergenic
1159600824 18:70427196-70427218 AGGAAGAAGCAGATAAAGGAAGG - Intergenic
1159773199 18:72573408-72573430 ATGAATAAGCAGAGCACGGAAGG - Intronic
1159944016 18:74430196-74430218 CAGGAGAAGCAGAGAAGGGTGGG + Intergenic
1160098709 18:75900915-75900937 AGGAAGAAGCAGAGAAGGAAGGG + Intergenic
1160437345 18:78861874-78861896 ATGCAGCAGCAGAGACGGGCGGG + Intergenic
1161214298 19:3085727-3085749 AAGTAGAAGAGGAGAGGGGAGGG - Intergenic
1161731099 19:5961064-5961086 GAGTAGAGGCAGAGAAGGAAAGG - Intronic
1162735381 19:12744281-12744303 ATGTAGAATCTATGAAGGGATGG - Intronic
1163764644 19:19156032-19156054 ATGTAGACGCAGAGGCTGGATGG + Intronic
1164292442 19:23880368-23880390 AAGAAGAAGCAGAGGAGAGAAGG + Intergenic
1164577570 19:29414527-29414549 TTTTAGAAGCAGAGATGGGTGGG - Intergenic
1164741053 19:30575885-30575907 ATGTAGAAGAGGGGGAGGGACGG + Intronic
1164864715 19:31595182-31595204 ATGGAGTTGCAGAGCAGGGAAGG + Intergenic
1164871279 19:31646134-31646156 ATGTAGAAACAGAGAGCAGAAGG - Intergenic
1165445277 19:35853448-35853470 ATGGAGAAGGAAAGAAGAGATGG - Intronic
1166301826 19:41915414-41915436 ATGGAGACCCAGAGATGGGAGGG - Intronic
1166336152 19:42108883-42108905 CTGTGAAAGCTGAGAAGGGACGG + Intronic
1166886632 19:45965223-45965245 TTGAAGAAGCAGAGAGAGGACGG - Intronic
1167136634 19:47620199-47620221 CTGCAGAAGATGAGAAGGGAGGG + Intronic
1167859700 19:52272825-52272847 ATGTCCCAGCAGAGAAGTGAGGG - Intronic
1168357766 19:55713021-55713043 GTGTTGGAGCAGAGTAGGGAAGG - Intronic
1168517254 19:57018061-57018083 ATGTAGAAGAGGAGATGAGATGG - Intergenic
1168579543 19:57543329-57543351 GTGTAGAGGGAGGGAAGGGATGG - Intronic
924959996 2:26271-26293 AGGCAGAAGGAGAGAGGGGAAGG + Intergenic
925006401 2:446109-446131 AAGACGAAGCAGGGAAGGGAGGG + Intergenic
925621720 2:5800252-5800274 CTGAAGGAGCACAGAAGGGATGG + Intergenic
926173640 2:10569882-10569904 GCGTAGAAACAGAGAAGAGAAGG + Intergenic
926432376 2:12801393-12801415 ATGGAGGATGAGAGAAGGGAGGG + Intergenic
927283325 2:21330814-21330836 TAGGAGAAGCAGAGAAGGTAGGG + Intergenic
927607640 2:24502067-24502089 ATATAAAAGCAGCCAAGGGATGG - Intronic
927686409 2:25174421-25174443 AGGAAGAAGCAAGGAAGGGAGGG + Intergenic
928884100 2:36128960-36128982 ATGTCACAGCAGAGAAGGGTGGG - Intergenic
929593841 2:43163335-43163357 CAGGAGAGGCAGAGAAGGGAGGG - Intergenic
929627135 2:43420991-43421013 ATCTAGAAGCAGAGATTGGAAGG - Intronic
929822959 2:45288122-45288144 ATGGAGAAGCAGAGAAGCCAGGG - Intergenic
929836549 2:45406229-45406251 ATGGAGGAGCAGTGTAGGGAAGG + Intronic
930465216 2:51739271-51739293 GTATAGAAGTAGGGAAGGGAAGG + Intergenic
930696513 2:54417072-54417094 ATGAGAAAGCACAGAAGGGAAGG + Intergenic
930741254 2:54835035-54835057 AGGGAGAAGCAGCGAGGGGAAGG - Intronic
930919857 2:56739412-56739434 TTGAAGAAAGAGAGAAGGGAGGG - Intergenic
931022791 2:58068628-58068650 ATGTAGAATCCCAGAAGAGAAGG - Intronic
932090712 2:68803845-68803867 CTGTTGAGACAGAGAAGGGAGGG + Intronic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
932649209 2:73537397-73537419 CTGTACAAGAAGAAAAGGGAAGG + Intronic
933104379 2:78304568-78304590 ATCTAGAATCTGAGGAGGGATGG - Intergenic
933409775 2:81910375-81910397 ATAGAGAATGAGAGAAGGGAAGG - Intergenic
933450150 2:82438799-82438821 ATGGAGAAGGGGAGAAGGAAGGG - Intergenic
933500697 2:83107579-83107601 ATCTTGCATCAGAGAAGGGACGG - Intergenic
933668236 2:84982330-84982352 ATGTTGAAGTAGAGCAGGCAGGG + Intronic
935854977 2:107263944-107263966 ATGAGGAAGCAGAGACTGGAGGG - Intergenic
936049977 2:109215345-109215367 ATTTAACACCAGAGAAGGGAGGG + Intronic
936061524 2:109298198-109298220 AAATAGATGCAGAGAAGGGAAGG + Intronic
936255084 2:110904369-110904391 AAGGAGAAGCAGGGAAGGGTGGG + Intronic
936645796 2:114368964-114368986 ATTAAGAAGGAGAGAAGGGGAGG - Intergenic
937077164 2:119115504-119115526 GTGTAGAAGCGAAGAAGGGCAGG - Intergenic
938575638 2:132600947-132600969 CTGGAGATGCAGAGGAGGGAAGG - Intronic
938730399 2:134142678-134142700 AATCAGAAGCTGAGAAGGGAAGG + Intronic
938742444 2:134245601-134245623 AAGGAGAAGCAGAGGAGGAAGGG - Intronic
938959200 2:136325831-136325853 ATGAAGAATGAGAGAAGAGAAGG - Intergenic
939343321 2:140929014-140929036 ATTTTGAAGCAGAGAAGTGACGG + Intronic
940361060 2:152796177-152796199 ATGATGAAGCAGAGAAGACAAGG + Intergenic
941451594 2:165666605-165666627 ATGAAGAAAGAGAGAAAGGAAGG + Intronic
941920987 2:170850524-170850546 AGGTAGAAGCAGACTAAGGAGGG + Intronic
942679166 2:178458793-178458815 ATGGGGAAGCAGCGAACGGAGGG - Intronic
942817226 2:180065981-180066003 ATGGAGCAGAAGAGAAGGGGAGG + Intergenic
942887915 2:180951117-180951139 TTCTAGAAGAAGAGAATGGAGGG - Intergenic
943328852 2:186534805-186534827 AAGTGAAAGAAGAGAAGGGAAGG - Intergenic
943553904 2:189377239-189377261 ATTGTAAAGCAGAGAAGGGAAGG - Intergenic
944078353 2:195757621-195757643 GTGTAGAAACAAAGAGGGGAAGG + Intronic
944099687 2:196010121-196010143 AAGAAGAAGAAGAGCAGGGAGGG - Intronic
944329155 2:198445137-198445159 ATCTAGAAAAACAGAAGGGAAGG - Intronic
945148951 2:206767765-206767787 TTGAAGAAGGAGAGAAGGGAAGG + Intronic
945200712 2:207278202-207278224 ATTTAGCAGCAGAGGAGAGAAGG - Intergenic
945461063 2:210109370-210109392 AGGAAAAAGCTGAGAAGGGAAGG - Intronic
945493285 2:210480524-210480546 AGGAAGAAACAGAGAAGGCATGG - Intronic
946721691 2:222615568-222615590 ATGTAGGAGCAGAGTAAGCATGG - Intronic
947838254 2:233190329-233190351 CTTGAGAAGCAGAGAAGGGCAGG - Intronic
948068087 2:235097119-235097141 ATGGAGAGGCTGAGCAGGGAGGG + Intergenic
948162978 2:235840362-235840384 ATGTAGGGGCAGAGAAGACAAGG + Intronic
948528500 2:238588185-238588207 AGACAGATGCAGAGAAGGGAAGG - Intergenic
948699969 2:239753358-239753380 ATGGAGCAGCAGGGAAGGGGTGG - Intergenic
1169163726 20:3405471-3405493 ATGTAGAAGTGGGGAAAGGAGGG + Intronic
1169300772 20:4440351-4440373 AGGTAGAAGAAGAGAAGTGGAGG + Intergenic
1169555787 20:6748338-6748360 ATGCAGAAGCAGACAAAAGATGG + Intergenic
1169771913 20:9210397-9210419 ATGTATAAGCATGGAAGGGAGGG - Intronic
1169979075 20:11363416-11363438 AAGGAGAAGGAGAGAATGGAAGG - Intergenic
1170256172 20:14346385-14346407 ATGTAGGAGCAAAGAAGCCAAGG - Intronic
1170700047 20:18695550-18695572 ATGGAGGGGAAGAGAAGGGAAGG - Intronic
1170728863 20:18955010-18955032 ATAGAGAAGCAGGGAAGGGCAGG - Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1172617088 20:36296255-36296277 AAGGAAAAGCAGAGAAGGTAAGG - Intergenic
1172643391 20:36455251-36455273 AGGGAGAAGCAGAGAACTGAGGG - Intronic
1173443239 20:43096125-43096147 AGGGAGAGGCAGAGAAGAGAGGG - Intronic
1173464420 20:43269648-43269670 AAGTAGAGGGAGAGAAGAGAGGG + Intergenic
1173673516 20:44814170-44814192 ATGTGGATCCAGAGAAGGAAGGG + Intergenic
1173927853 20:46794018-46794040 ATGAAGAAGCAAAGTAGGGTGGG - Intergenic
1173948662 20:46972673-46972695 AAGTTGAAGCAGAGAAGTCAAGG + Intronic
1174960546 20:55151847-55151869 ATGTAAAAGATGAGGAGGGAGGG - Intergenic
1175160660 20:57005331-57005353 AGGTACCAGCAGGGAAGGGAAGG + Intergenic
1175604089 20:60298369-60298391 AGGCAGAGGCAGAGATGGGAGGG - Intergenic
1176282740 20:64323885-64323907 AGGTAGAAGGGGAGAAGAGAAGG + Intergenic
1176808762 21:13516435-13516457 ATGTAGAAGGAGGAAAGAGAGGG + Intergenic
1177115070 21:17075345-17075367 AATAAGAAGAAGAGAAGGGAGGG - Intergenic
1177265211 21:18774738-18774760 ATGTAAAATCGGTGAAGGGAGGG - Intergenic
1177680672 21:24365528-24365550 ATGTAGAAAGAGAGATGGAAAGG - Intergenic
1177781312 21:25625341-25625363 ATGCAGAAAGAGGGAAGGGAGGG + Intergenic
1177955090 21:27588376-27588398 ATATAGAAAGAGAGAAAGGAAGG + Intergenic
1177965924 21:27726074-27726096 ATGTGTCAGCAGACAAGGGAAGG + Intergenic
1178037707 21:28603180-28603202 CTGAAGAAGCAGGGCAGGGATGG - Intergenic
1178348321 21:31851155-31851177 TTGGAGGAGCAGAGGAGGGAGGG - Intergenic
1178611869 21:34089734-34089756 AAGTTGAGGCAGAGTAGGGAGGG - Intronic
1179142877 21:38742160-38742182 AGGAAGAAGTAGAGAAGGGAGGG + Intergenic
1180316863 22:11283718-11283740 AGCAAGAAACAGAGAAGGGAAGG + Intergenic
1180338467 22:11599797-11599819 ATCAAGAAACAGAGAAAGGAAGG - Intergenic
1181418550 22:22779674-22779696 AAAAAGAAGGAGAGAAGGGAAGG + Intronic
1181760402 22:25054539-25054561 CTGTAGAAGCAGAGATGCGTAGG + Intronic
1182150495 22:28024042-28024064 AGGTACAGGCACAGAAGGGAGGG - Intronic
1182184109 22:28384130-28384152 ATGTATAAGCAGAGACCTGAAGG - Intronic
1183153088 22:36053514-36053536 AGGGAGAAGCAGGGAAGGGAAGG - Intergenic
1183387227 22:37521827-37521849 ATGTAGAAGTTGAGAGGGGGAGG - Intergenic
1184009875 22:41739415-41739437 AAGTAGAAGTAGGGAAGAGAGGG - Intronic
1184103972 22:42356830-42356852 ATGAAGAAACAGAGAGGTGAAGG + Intergenic
1184331181 22:43828943-43828965 CTGTAAAAGGAGAGCAGGGAGGG + Intronic
1184583847 22:45434589-45434611 ATGTAAAGCCAGAGAGGGGAGGG + Intergenic
1184914453 22:47559481-47559503 GTGAGGAAGCAGAGGAGGGAAGG + Intergenic
949098844 3:119181-119203 AAGTATAAGCAGAGTAGGAAGGG + Intergenic
949791077 3:7792755-7792777 ATGTAGCAGAAGAGATGGAAGGG - Intergenic
950002453 3:9667694-9667716 AGGTAGCAGCAGACAAGGGGTGG - Intronic
950168244 3:10817311-10817333 ATGTAGAAGGGGAGAGGGAAAGG + Intronic
950360797 3:12448259-12448281 AGGAAGAAGAAGAGAAGGAAGGG + Intergenic
950383175 3:12634733-12634755 AAGGAGTAACAGAGAAGGGAAGG + Intronic
950545248 3:13634435-13634457 ATGGAGATGCCCAGAAGGGAAGG - Intronic
950670315 3:14521877-14521899 ATGAAGAAGCAGGGAATGGGTGG + Intronic
951393157 3:22131544-22131566 ATGTATCAGGAGAGAATGGAAGG + Intronic
951825510 3:26863982-26864004 ATGAAGAAGTAGAGAAGAGGAGG + Intergenic
952184465 3:30953793-30953815 TTGGAGGAGCAGAGCAGGGAAGG + Intergenic
952274594 3:31865062-31865084 AGGGAGAAGAAAAGAAGGGAGGG + Intronic
952504906 3:33998856-33998878 TTGTAGAAGAAGAGGAGTGAGGG + Intergenic
953057445 3:39399344-39399366 ATGGGAAAGGAGAGAAGGGAGGG + Intergenic
954299449 3:49691666-49691688 AGGAAGAAGCAGAGTACGGAAGG - Intronic
954484628 3:50836402-50836424 ATGTAGAAGCTGCCAAGGCATGG + Intronic
955393405 3:58537205-58537227 ATGTGGGAGGAGAGAAGGGCAGG - Exonic
956000386 3:64723861-64723883 TTGTAGAAGGGAAGAAGGGAGGG - Intergenic
956294595 3:67697985-67698007 ATGGAAAAGGAGAGAAGGCAAGG - Intergenic
957383636 3:79467503-79467525 ATAGAGAAGGAGAGAAGAGAAGG + Intronic
957386304 3:79501216-79501238 ATGTAGTAACAGAGAATGGATGG + Intronic
957411978 3:79853104-79853126 ATTTAGAAACAGAGAATGGAAGG - Intergenic
957632858 3:82740560-82740582 ATGGAGAAGCAGAGAGGAGAGGG + Intergenic
957875738 3:86144024-86144046 AGAGAGAGGCAGAGAAGGGATGG - Intergenic
959451633 3:106510759-106510781 AGGAAGAAGCAAAGAAAGGAAGG - Intergenic
959487076 3:106939096-106939118 ATCTAGAAGCAAAGATGAGATGG - Intergenic
959989647 3:112616761-112616783 ATGGAGAAGCAGAAGAAGGAGGG - Exonic
960208400 3:114930839-114930861 ATGTTGCAGCAGAAAAGGGTGGG + Intronic
960447210 3:117763190-117763212 AGAGAGAAGCAGAGAGGGGAAGG + Intergenic
960494142 3:118354923-118354945 CTGTAGATGCACAGAAGGAAAGG + Intergenic
960547128 3:118928360-118928382 ATGGAGAAGGAGAGAAGAGATGG + Intronic
961099932 3:124190158-124190180 AGGATGAAGAAGAGAAGGGAAGG + Intronic
962010183 3:131384097-131384119 ATGTAGATGAAGTGAAGGCAGGG - Intronic
962313454 3:134342394-134342416 ATGGAGAAGCTGAGAAGTGGAGG + Intergenic
963005046 3:140719144-140719166 AGGGAGAAGAAGAGAAGAGAAGG - Intergenic
963499615 3:146109020-146109042 ATGCTCAAGCAGAGAAGTGATGG + Intronic
963504837 3:146171283-146171305 ATGAAAAATCAGAGAAGGTAAGG - Intergenic
963604984 3:147406011-147406033 ATTCACAAGGAGAGAAGGGAAGG + Intronic
963728452 3:148947673-148947695 ATGAAGAAACAGAGAAGGAAAGG + Intergenic
964182330 3:153903670-153903692 CTGTAGCAGCACAGGAGGGAGGG + Intergenic
964982844 3:162707656-162707678 ATGTAAATGTAGAGAAGGGGTGG + Intergenic
965301827 3:167014490-167014512 ATGTAGAATGAGAAATGGGAAGG - Intergenic
965317021 3:167204977-167204999 ATGGAGAAGATGAGAAGAGAAGG + Intergenic
966109763 3:176385283-176385305 ATGTAGCAGCAGAGAACACATGG - Intergenic
966231547 3:177657810-177657832 ATGTAGAAGCAGAGTTGTGATGG + Intergenic
966286324 3:178300173-178300195 ATTTAGAAGCAGTGAAGGTAAGG + Intergenic
966400518 3:179542693-179542715 AAAGAGAGGCAGAGAAGGGAGGG + Intergenic
966589974 3:181671501-181671523 ATGTAGAAAATGAGAAGAGATGG + Intergenic
966614534 3:181899097-181899119 ATGTGGTAGGAGAGAAGAGAAGG - Intergenic
966683374 3:182667303-182667325 AAGAAGAAGGATAGAAGGGAGGG + Intergenic
967018829 3:185504836-185504858 ATGGAAAAGCAAACAAGGGAGGG + Intergenic
967223067 3:187265525-187265547 TTTTAGAAGCAGAGAAGAGAAGG + Intronic
967232695 3:187355285-187355307 TTGTAGAAACAAAGAAAGGAAGG - Intergenic
967443450 3:189536661-189536683 ATTTAAAAACAGAAAAGGGATGG - Intergenic
967779340 3:193418907-193418929 ATGTAGCGGCAGATCAGGGATGG - Intronic
968330501 3:197865108-197865130 CTGTAGAGGCTGAGGAGGGAGGG - Intronic
969245637 4:5930930-5930952 ATAAAGAAGGAAAGAAGGGAGGG + Intronic
969646243 4:8431166-8431188 AGGGACAGGCAGAGAAGGGAGGG - Intronic
970218840 4:13786497-13786519 ATGAAGAAGGAAAAAAGGGAGGG - Intergenic
970410449 4:15801902-15801924 ATGTGGAATCAGAGTAGTGAGGG - Intronic
970904064 4:21194692-21194714 ATCAAGCTGCAGAGAAGGGAAGG - Intronic
971019387 4:22518225-22518247 ATATAGCAGCAGAAAAGGGCTGG - Intergenic
971595381 4:28520996-28521018 AGGTAGAAGGAGAGGAAGGAAGG - Intergenic
972544896 4:40071172-40071194 AAGGAGAGGCAGAGTAGGGAAGG - Intronic
972696834 4:41454853-41454875 ATGCAGAATCAGAGAAGGTCAGG - Intronic
972785897 4:42326634-42326656 ATGTTGAAGGAAAGAAGGAAGGG + Intergenic
973088958 4:46107486-46107508 AGGAAGAAGAAGAGAAGGAAAGG - Intronic
973193142 4:47409491-47409513 ATAGAGAAGGAGAGAAGAGAAGG - Intronic
973241022 4:47955717-47955739 ATGCAGTGGCAGAGAAGAGAAGG - Intronic
974328647 4:60447782-60447804 AAGTAGGAGTAGTGAAGGGAGGG + Intergenic
974616213 4:64285843-64285865 ATGTGGAAGCTTAAAAGGGAAGG + Intronic
975206190 4:71646353-71646375 ATCTTGAAGCAGGGAAGTGAGGG + Intergenic
975512775 4:75211706-75211728 ATGTAGAAATTGAGGAGGGAAGG - Intergenic
975612051 4:76213358-76213380 ATGTAGCAGCAGGGATGGGAGGG + Intronic
975891368 4:79032631-79032653 ATGGAGAGGCAGAGGTGGGAGGG + Intergenic
975905334 4:79204553-79204575 AAGTAGAAGGAGAGAAGGAAGGG - Intergenic
976119532 4:81764203-81764225 ATGTATAAAGAGAGCAGGGATGG + Intronic
976332362 4:83846873-83846895 ATGGACTAGCAGAGAATGGAAGG + Intergenic
976621798 4:87135885-87135907 ATGCAGAAGCAGAGATGAGGAGG + Exonic
976714813 4:88112457-88112479 AAGTTTAAGCAGAGAAGGGGTGG - Intronic
976716648 4:88129987-88130009 AAAAAGAGGCAGAGAAGGGAGGG + Intronic
976904161 4:90215858-90215880 ATGAAGCAGGAGAGAAGGGCAGG + Intronic
977009090 4:91613076-91613098 ACCTAGAAACAAAGAAGGGAAGG + Intergenic
977209180 4:94198574-94198596 ATGCATAAGCAGAAAAAGGAAGG + Intergenic
977654200 4:99503304-99503326 AGGTGAAAGGAGAGAAGGGATGG - Intergenic
977790927 4:101102214-101102236 ATGAAGAAGGAAAGAAAGGAGGG + Intronic
978197876 4:105991597-105991619 TTGTGCAAGCAGAGAAGGAAAGG + Intronic
978491212 4:109314083-109314105 ATTTAAATGCAGAGGAGGGAAGG - Intergenic
979088796 4:116451401-116451423 AAGGAGAAGAAGAGAAGAGAAGG + Intergenic
979141002 4:117174500-117174522 AGGTGGAAGGAGAGAGGGGAGGG + Intergenic
980126641 4:128780616-128780638 GTATGGAAGCAGAGAAGTGATGG + Intergenic
980445563 4:132902470-132902492 TAGTAGAAGCACAAAAGGGATGG - Intergenic
981875000 4:149531508-149531530 TTGTTGAAGGAAAGAAGGGAAGG - Intergenic
982044369 4:151428458-151428480 ATGTAGTAACACAGAAGAGAAGG - Intronic
982072039 4:151704339-151704361 AGCTGGAAGCAGAGAAGGAAAGG + Intronic
982413247 4:155103347-155103369 ATGTAAAAGCAGGGATTGGAGGG - Intergenic
982816479 4:159891905-159891927 AGGTAGGAGAAGGGAAGGGAAGG - Intergenic
983000032 4:162402836-162402858 GAGTAGAAGCAGAGGAGGAAGGG - Intergenic
983552548 4:169032374-169032396 AGGAAGAAGGAAAGAAGGGAAGG - Intergenic
984617537 4:181915644-181915666 GAGGAGAAGCAGAGAGGGGAGGG + Intergenic
984715589 4:182921581-182921603 CTGTAGAAGCAAAGAAGTCATGG - Intergenic
984736478 4:183113268-183113290 ATGTAGAAACAGAGGGAGGAGGG + Intronic
985816338 5:2130866-2130888 TTTTTGAAGCAGAGAAGAGAGGG - Intergenic
985898985 5:2772007-2772029 ATATACAAGCATAGAATGGAAGG + Intergenic
986264112 5:6178150-6178172 AGGTACAAACAGAGAAGGAAAGG + Intergenic
986470375 5:8067830-8067852 ATGAAGTAGGAGAGAAAGGAGGG + Intergenic
986743379 5:10723535-10723557 AAGAAATAGCAGAGAAGGGATGG + Intronic
986788711 5:11139877-11139899 ATGTAGAAGCTGGGAAAGGCAGG - Intronic
986990811 5:13550971-13550993 AAGAAGAAGAAGAGATGGGATGG + Intergenic
987149095 5:15020849-15020871 AAGGAGAAGCAGAGAGAGGAGGG + Intergenic
987255160 5:16143119-16143141 ATGAAGGAACAGAGAAAGGAGGG - Intronic
988015484 5:25552592-25552614 ATATGAAAGCAGAGAATGGATGG - Intergenic
988550959 5:32200571-32200593 AGGAAGAAGCAAGGAAGGGAGGG + Intergenic
988620680 5:32820289-32820311 ATGTAGGCACAGAGAAGGGAAGG + Intergenic
989134894 5:38144043-38144065 ATGTGGAAGCAGTGAAGGCTTGG - Intergenic
989141983 5:38210585-38210607 ATGTAGAAAGAGAGGAGGAAAGG + Intergenic
989151067 5:38300344-38300366 ATAGAGAAGAAGAGAAGAGAAGG - Intronic
989428437 5:41323785-41323807 ATGTAGAAGGAGAGGAAGAAAGG + Intronic
989992569 5:50785349-50785371 ATGTAGAAAGAGAGAAAGAAGGG - Intronic
990262286 5:54036416-54036438 ATGTAGAAGTAGAAATTGGATGG - Intronic
991032326 5:62095617-62095639 AGGGAGAAACAGAGAAGGGAAGG + Intergenic
991147457 5:63323547-63323569 AGGTAGAAGAAAAGAAGGAATGG + Intergenic
991196286 5:63936364-63936386 ATGTAGAAGAGGAGAAGGTGGGG + Intergenic
991308103 5:65202954-65202976 ATGTGGAGGAAGAGAAGAGAAGG - Intronic
992365778 5:76087918-76087940 ATTTGGTAGCAAAGAAGGGAAGG + Intronic
992934264 5:81685568-81685590 TTATAGAACCAGAGAAGGGGAGG + Intronic
993048659 5:82898680-82898702 AAGTTGAAGGAGAGAAAGGAAGG + Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
996079198 5:119236675-119236697 ATCTAGAGGCAGAGGAGGGTGGG + Intronic
996173163 5:120321722-120321744 ATGAAGGAGTAGAGAAGGAATGG + Intergenic
996246274 5:121267370-121267392 AAGTAGAAGCAGATTTGGGAGGG - Intergenic
996271440 5:121609322-121609344 AGGTGGCAGCAGAGAAGGAATGG + Intergenic
996671284 5:126120776-126120798 GTGTTCAAACAGAGAAGGGAAGG - Intergenic
997401622 5:133607898-133607920 CGGTAGAAGGAAAGAAGGGAGGG + Intronic
997606141 5:135176993-135177015 CTGAAGAAGCAGGGAATGGAGGG + Intronic
997787212 5:136724429-136724451 ATGTAGAAACATAGACAGGAAGG - Intergenic
997792114 5:136770505-136770527 AAGTCGCAGCAGAGAAGGAAAGG + Intergenic
997906204 5:137819726-137819748 ATGTAGAATTAGAGAAAGGCTGG - Intergenic
998729333 5:145056244-145056266 ATAGCGAAGCAGAGGAGGGAGGG - Intergenic
998750768 5:145319040-145319062 ACAGAGAAGCAGAGAAGAGAAGG - Intergenic
999859023 5:155625088-155625110 ATGGAGACGGAGAGAAGGCAAGG + Intergenic
1000052515 5:157575341-157575363 AAGGAGAAGGCGAGAAGGGAAGG + Intronic
1000113446 5:158131558-158131580 CTGCAGAGGCACAGAAGGGAGGG - Intergenic
1000762542 5:165244185-165244207 AGAAGGAAGCAGAGAAGGGAAGG + Intergenic
1001605515 5:172957349-172957371 ATGATCAAGCAGAGCAGGGAAGG - Intergenic
1001621816 5:173093113-173093135 ATTTAGGAGCAGGGAGGGGAAGG + Intronic
1001697120 5:173679142-173679164 ATGGAGTATCTGAGAAGGGAGGG + Intergenic
1001739748 5:174042759-174042781 ACTTAGAAGTAGAGAAGAGATGG + Intergenic
1001810092 5:174620976-174620998 ATGAAGAGGCAGAGATAGGAAGG - Intergenic
1001877428 5:175213497-175213519 GTGAAGAAGGAAAGAAGGGAGGG - Intergenic
1001946498 5:175782879-175782901 CAGTAGGAGCTGAGAAGGGAGGG - Intergenic
1002453207 5:179331310-179331332 ATGAGGGAGAAGAGAAGGGAGGG + Intronic
1002555216 5:180032368-180032390 AGGAAGAAGGAAAGAAGGGAGGG - Intronic
1002631342 5:180581718-180581740 ACATACAAGCAGCGAAGGGAGGG + Intergenic
1002938160 6:1692044-1692066 GTGTAAAAGCAGACATGGGAAGG + Intronic
1003138625 6:3453811-3453833 AAGTAGAAGCAGAAAGTGGAAGG - Intronic
1003504488 6:6728451-6728473 ATGTTGAAGCAGAGAATAGAAGG + Intergenic
1003694080 6:8384971-8384993 TTGAAAAAGCAGAAAAGGGAAGG + Intergenic
1003865589 6:10359721-10359743 ATAAAGAAGGAGAGAAGGAAAGG - Intergenic
1004342403 6:14819058-14819080 ATACAGATGCAGAGAAGGAATGG - Intergenic
1005435134 6:25801743-25801765 ATGTAAAGGCAGAGTAGGAATGG - Intronic
1005692399 6:28320190-28320212 AAGAAGAAGAAAAGAAGGGAGGG + Intergenic
1005795484 6:29356607-29356629 ATGAAAAAGGAGAGCAGGGATGG - Intronic
1005917601 6:30367036-30367058 ATGGAGACACAGAGAAGTGAAGG + Intergenic
1006030885 6:31175780-31175802 CTGCAGAAGGAGAGAAGGGAAGG - Intronic
1006104941 6:31710818-31710840 TTGTAGCAGCAGTGGAGGGATGG + Intronic
1006278707 6:33029016-33029038 ATGGAGAAGGAGAGAGGGGGAGG - Intergenic
1006516881 6:34550210-34550232 TTGGAGGAGCAGAGAAGGGGTGG - Intronic
1007511921 6:42380479-42380501 ATGGAGGTCCAGAGAAGGGAAGG - Intronic
1007738994 6:43999841-43999863 ATCTAGAAGCATGGGAGGGAAGG - Intergenic
1008546151 6:52585469-52585491 CTTTAGAAGCAAAGAAAGGAAGG + Intergenic
1008959248 6:57249211-57249233 TTGCAGAAGCAGGGAAGGAAAGG - Intergenic
1009291324 6:61886382-61886404 ATTTAGAAGCAGAGAGAAGAGGG - Intronic
1009360842 6:62810696-62810718 ATGAAGAAACAGTCAAGGGAAGG + Intergenic
1009369900 6:62886124-62886146 GTGCAAAAGCAGAAAAGGGAGGG + Intergenic
1010175037 6:73018094-73018116 ATGCAGAAATAGAGAAGGGCCGG + Intronic
1010551506 6:77228573-77228595 TTCCAGCAGCAGAGAAGGGATGG - Intergenic
1010705670 6:79106444-79106466 ATGTGGGAGCAGAAAAGAGAAGG + Intergenic
1010733284 6:79413141-79413163 AGGGAGAAGGAGAGAAGAGAAGG - Intergenic
1011108522 6:83810751-83810773 GAGTGGAAGCAGAGAAGTGACGG - Intergenic
1011194632 6:84768449-84768471 AGCTAGAAGCAGAAATGGGACGG + Intergenic
1011622351 6:89255021-89255043 AGTCAGAAGCAGAGAAGGGTTGG + Intergenic
1012167653 6:95978462-95978484 ATGACTAAGCAGAGAAGGGAGGG - Intergenic
1012228252 6:96729897-96729919 CTCTAGAAGCAGAAAAGGCAAGG + Intergenic
1013536755 6:111069565-111069587 AGGCAGAATCAGAGAATGGATGG - Intergenic
1013575572 6:111481870-111481892 ATGTTGAAGAAGGGATGGGAAGG - Intronic
1013878298 6:114861884-114861906 GTGGGGAAGCAGAGCAGGGAAGG + Intergenic
1013990620 6:116251045-116251067 ATGCAGAAGCTGAGAAATGAGGG + Exonic
1014180144 6:118375274-118375296 TTTTAGAAGGAAAGAAGGGAGGG + Intergenic
1014316463 6:119871859-119871881 TTGTAAAGGCAGAGAAGAGAAGG - Intergenic
1014555505 6:122840132-122840154 ATGCAAAGGCAGAGAAGGGAAGG + Intergenic
1015402167 6:132798878-132798900 ATGTAGACACAGAAAAGGCAGGG + Intergenic
1015481054 6:133710264-133710286 ATGGAGGAAGAGAGAAGGGAAGG + Intergenic
1015592617 6:134836984-134837006 ATGTGGAAGAAGAGGAGTGAAGG - Intergenic
1015836531 6:137426240-137426262 TTGTAGAAGATGAGAATGGAAGG + Intergenic
1016120911 6:140340198-140340220 ACTTAAAAGCAGAGAAGGAAAGG + Intergenic
1016322249 6:142858522-142858544 AAGATGAAGCAGATAAGGGAGGG - Intronic
1016354095 6:143198990-143199012 CTGCAGTAGCAGAAAAGGGAAGG + Intronic
1016706648 6:147116604-147116626 AGATAGAGGCAAAGAAGGGAAGG + Intergenic
1016850768 6:148616535-148616557 GTGATGAAGCAGAGAGGGGAAGG + Intergenic
1017080311 6:150662127-150662149 AGGTTGAAGGAGAGAAGGCAGGG + Intronic
1017300556 6:152852723-152852745 ATGGAGAAGGGAAGAAGGGAGGG - Intergenic
1017555074 6:155555498-155555520 CAATAGAAGCAGGGAAGGGAAGG - Intergenic
1017848247 6:158278803-158278825 TTGTAGAACCAGTGAAAGGAAGG + Intronic
1017954372 6:159166845-159166867 AGTTAAAAGCAGAGAAGGGGAGG - Intergenic
1017967016 6:159275792-159275814 GTGGGGAATCAGAGAAGGGATGG - Intergenic
1018078860 6:160241401-160241423 ATGAAGTAGAAGAGAAGTGAAGG + Intronic
1018365935 6:163119920-163119942 ATGTGGAAGCAGAAAATGAATGG - Intronic
1018464295 6:164029206-164029228 ATGGAGGAACAGAGAAGCGAGGG - Intergenic
1018498255 6:164372450-164372472 ATGAAGACGCAGAGAAGACATGG + Intergenic
1018591833 6:165434270-165434292 AGATAGAAGGACAGAAGGGAAGG - Intronic
1018730361 6:166645630-166645652 AGGTAGATCCAGAGAAGGGGGGG - Intronic
1018818504 6:167354557-167354579 CTTTAGAAGCAGACAATGGAAGG - Intronic
1019135638 6:169905974-169905996 GAGCAGAAGGAGAGAAGGGAAGG + Intergenic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1019750968 7:2729565-2729587 ATGCAGAAGCAGAAGAGGGAGGG - Exonic
1019895465 7:3979149-3979171 AGGCAGAAGCTGAGAAGTGAGGG - Intronic
1020372660 7:7451039-7451061 ATGTGTGAGGAGAGAAGGGAGGG + Intronic
1020582085 7:10015409-10015431 AAGTAAGAGCAGACAAGGGATGG + Intergenic
1021439187 7:20659001-20659023 ATGTAGAAGAAGCAAAGGGTGGG - Intronic
1021961809 7:25880781-25880803 AGATAGAACCAGGGAAGGGAGGG - Intergenic
1022566893 7:31412877-31412899 ATGAAGAAGGAGGGAAAGGAAGG + Intergenic
1022632998 7:32103207-32103229 ATTTGGAAGCAGAAAAGGGAGGG + Intronic
1023313049 7:38907331-38907353 ATGCAGAGTCACAGAAGGGAAGG + Intronic
1024844580 7:53627202-53627224 TTGTAGTAGCAAAGAAGGAAAGG - Intergenic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026728992 7:72894933-72894955 ATGTGGAAGCTGAGGTGGGAGGG - Intronic
1026877958 7:73890534-73890556 TGGGAGAAGGAGAGAAGGGAGGG - Intergenic
1027481985 7:78709394-78709416 ATGTAGAAGCTTAGAAAAGAAGG - Intronic
1027748310 7:82107427-82107449 AGGGAGAAGCAGAGAGAGGAAGG - Intronic
1027888295 7:83937689-83937711 ATTTCGAAGGAGAGAAGAGAAGG + Intergenic
1027969910 7:85066292-85066314 AGGGAGGAGGAGAGAAGGGATGG + Intronic
1028098391 7:86790608-86790630 AGGTAGGGGCAGAGCAGGGAGGG - Intronic
1028167600 7:87556492-87556514 ATGTAGAAGCAGAGAAGGGAAGG + Intronic
1028663361 7:93310619-93310641 ATGTAGAAGAAGTGAACAGAGGG - Intronic
1029449412 7:100632528-100632550 AGAGAGAAACAGAGAAGGGAGGG - Intronic
1029916883 7:104219402-104219424 CTGTAGAAGCAGAGACTTGAAGG - Intergenic
1030214897 7:107034620-107034642 ATTTAGGAGCAGAAAAGAGAAGG - Intergenic
1030484907 7:110153029-110153051 ATGCAGAAGAAGAAAAGGCAAGG + Intergenic
1031069548 7:117146526-117146548 GTGTAGCAGCAGAGAAGCGGAGG + Intronic
1032055286 7:128679629-128679651 GTGTAGAAGCACAGGAAGGAAGG + Intronic
1032461859 7:132117830-132117852 ATGTAGAAGCAGAGGAGCCCCGG - Intergenic
1032686035 7:134234758-134234780 AGGAAAAAGGAGAGAAGGGAAGG - Intronic
1032743224 7:134760316-134760338 ATGGAGAGGCAGAGCAGGCAGGG + Intronic
1032918972 7:136524773-136524795 ATGTAAATACAGAAAAGGGATGG + Intergenic
1033253952 7:139783398-139783420 ATGTAGATGCACAGAAGGTAGGG + Intronic
1034408880 7:150926437-150926459 ATGCTGGAGCAGACAAGGGAGGG + Intergenic
1034534900 7:151720644-151720666 ATGAAGGAGGAGAGAATGGAGGG + Intronic
1034551907 7:151826130-151826152 ATGGAGAAAGAGAGAATGGATGG - Intronic
1034627055 7:152501780-152501802 ATGGGGACCCAGAGAAGGGAGGG - Intergenic
1035012572 7:155732704-155732726 AGGTGGAAGCAGAGAAGAGGGGG + Intronic
1035098372 7:156375948-156375970 CTCAAGAAGCAGAGAAGGCATGG - Intergenic
1035353719 7:158264913-158264935 GTGTAAAGGCAGAAAAGGGAGGG - Intronic
1036718064 8:11144986-11145008 ATGGAGAAAGGGAGAAGGGAGGG + Intronic
1036943209 8:13070720-13070742 ATGAGGAAGCAGAGATTGGAAGG - Intergenic
1037147600 8:15592094-15592116 ATGTAGAAGATGAGGAAGGAAGG + Intronic
1037559291 8:20058087-20058109 ATGTGGATGGAGAGATGGGAAGG - Intergenic
1037808193 8:22069922-22069944 ATCTATAAGCAGAGAGGTGAGGG + Exonic
1038065432 8:23958832-23958854 AGGAAGAAGGAAAGAAGGGAAGG - Intergenic
1038138243 8:24814068-24814090 AAGTAGAAGGAGAGACAGGAAGG - Intergenic
1038403543 8:27305026-27305048 ATGGAGGTGCAGAGAAGTGAAGG - Intronic
1038476951 8:27875258-27875280 ATGTAGAAGGGAAGAAAGGAAGG - Intronic
1038600011 8:28930710-28930732 ATATAGGAGGAAAGAAGGGAGGG - Intronic
1038740952 8:30216140-30216162 CTGTAGAGACAGAGGAGGGAGGG - Intergenic
1038863758 8:31416049-31416071 TTGTAGAAGCATAGTTGGGAAGG + Intergenic
1038958665 8:32495055-32495077 ATGTAGAAGCAAAGAATCAAAGG - Intronic
1041347925 8:56920676-56920698 AGGGAGAAGCAGAGAAAGGTGGG + Intergenic
1041580578 8:59455367-59455389 ATGTTGAATAAAAGAAGGGAGGG + Intergenic
1044035582 8:87299250-87299272 ATGTGGAAGGAGAGGAAGGAAGG - Intronic
1044384708 8:91573774-91573796 ATGTACAAGTGGAGGAGGGAGGG + Intergenic
1045487167 8:102640577-102640599 AAGAGGAAGGAGAGAAGGGAGGG + Intergenic
1046050574 8:109017228-109017250 AGGAGGAAGCAGAGAAGGAAAGG + Intergenic
1046058544 8:109108253-109108275 ATGGAGAAGGAGAGAGGTGATGG - Intronic
1046724250 8:117657095-117657117 ATGCAGAAGTTTAGAAGGGATGG - Intergenic
1047198539 8:122743751-122743773 ATGTAGAACCGGAGCAGGTAGGG + Intergenic
1047759927 8:127946880-127946902 ATGTCAGAGCAGGGAAGGGAAGG - Intergenic
1047991234 8:130288781-130288803 TTATAGAAGGAAAGAAGGGAGGG + Intronic
1048082419 8:131143045-131143067 TTGTAGATGCAGAGAAGGGAAGG - Intergenic
1048361860 8:133704222-133704244 ATGTAGAATAAGAGAAGACAGGG - Intergenic
1048473375 8:134722633-134722655 ATGAGGAAGCAGAGGAGGGGAGG + Intergenic
1048903238 8:139060531-139060553 CTGTGGAAGCAGAGATTGGAGGG - Intergenic
1049117660 8:140703340-140703362 CTGTAGAAGCTGATAAGGCAAGG + Intronic
1049718004 8:144102747-144102769 ATGAAGAGGCAGAGCAGGCAGGG - Intronic
1051159671 9:14192612-14192634 ATGTCAAAGCAGAGGAGGGAAGG - Intronic
1051900382 9:22032352-22032374 AAGTAGAAGGAATGAAGGGAAGG - Intronic
1052223459 9:26055543-26055565 AGGAAGAGGAAGAGAAGGGAAGG + Intergenic
1052380906 9:27770023-27770045 TTGTAGAAGCAAAGAAAGGCAGG + Intergenic
1052411809 9:28130982-28131004 AAGTAAAGGCAGAGATGGGAAGG - Intronic
1052661380 9:31436771-31436793 ATATAGAATCACAGAAGGAAAGG + Intergenic
1052955442 9:34250201-34250223 TTGGAGAGGCAGAGAAAGGAGGG - Intronic
1053133069 9:35629766-35629788 ATGTAGCAGCAGAGCATGGTGGG - Intronic
1053180874 9:35968967-35968989 AGGGGGAAGTAGAGAAGGGAGGG + Intergenic
1053214229 9:36257896-36257918 ATGTAGACTCAGAGCAGGGAGGG + Intronic
1053290868 9:36878983-36879005 ATGCAGAAGGAAAGAATGGAGGG + Intronic
1053402924 9:37843557-37843579 CCATAGAAGCAGAGAAGGGAAGG + Intronic
1053419349 9:37967501-37967523 TAGTAGAAGCACAGAGGGGAAGG + Intronic
1053438408 9:38093663-38093685 ATGTATAGGGAGAGAAAGGAAGG + Intergenic
1055356997 9:75447947-75447969 CAGTAGCAGCAGAGAAGAGAAGG - Intergenic
1055574744 9:77649232-77649254 ATTTTGATGCAGAAAAGGGAAGG + Intergenic
1056041870 9:82676598-82676620 ACTCAGAAGCAGAGATGGGAGGG - Intergenic
1056629679 9:88282860-88282882 CTGCAGAAGCAAGGAAGGGAAGG + Intergenic
1057458583 9:95238064-95238086 AAGTAGAAGGAGAGAAGCAACGG - Intronic
1057466031 9:95315538-95315560 ATGCAGAAGTGGAGAAGGAAAGG - Intronic
1057767992 9:97940365-97940387 ATCTAGAAGCAGAGTGTGGAGGG + Intronic
1058007743 9:99937346-99937368 TTGAAGGAGAAGAGAAGGGAGGG - Intronic
1058057883 9:100467623-100467645 AGGTAGAAGCCAAGAAGGCAAGG - Intronic
1058532998 9:105925328-105925350 ATGGAGAAGGAGAGAAAGGTGGG + Intergenic
1058846721 9:108967803-108967825 ATGGAGAAGCATAGATGGTAAGG + Intronic
1059067809 9:111103661-111103683 ATGTTCAAGCCAAGAAGGGAGGG + Intergenic
1059578584 9:115519159-115519181 AAGGAGAGGAAGAGAAGGGAAGG - Intergenic
1059619253 9:115985252-115985274 ATGTAGAAGGAGAAAACTGAGGG - Intergenic
1059998731 9:119939242-119939264 GTGTAAGAGCAGAGAAGAGAAGG + Intergenic
1060373506 9:123097802-123097824 ATGCAGAAGAAGAGAAAAGACGG + Exonic
1060379254 9:123150761-123150783 AGGTCCAAGCAGAGAAGGGCTGG + Intronic
1060753845 9:126194579-126194601 ATGAAGAAGGAGGGAAGGGAGGG - Intergenic
1061045498 9:128162871-128162893 ATCCAGGAGGAGAGAAGGGAAGG + Intronic
1061743961 9:132726294-132726316 AGGAAGAAGAAGAGAAAGGAAGG - Intronic
1203726758 Un_GL000216v2:56069-56091 ATGGAGAGGAAGAGAATGGAAGG - Intergenic
1203365166 Un_KI270442v1:249656-249678 AGCAAGAAACAGAGAAGGGAAGG + Intergenic
1185573804 X:1154496-1154518 ATGGGGAAGCAGGGAGGGGAGGG - Intergenic
1185574945 X:1163833-1163855 ATAAAGAAAGAGAGAAGGGAGGG + Intergenic
1185589845 X:1268749-1268771 ATGAGGAAGCAGGGGAGGGAGGG + Intergenic
1185745912 X:2573304-2573326 ATGAAGAAACAGAGAAAGTAAGG - Intergenic
1185972595 X:4681867-4681889 AGGAAGAAGGAGAGGAGGGAAGG + Intergenic
1185983673 X:4807025-4807047 TTGTAGAAGCAGTTTAGGGAGGG + Intergenic
1186586532 X:10880917-10880939 TTCCAGAAGCAGTGAAGGGATGG - Intergenic
1186598740 X:11013019-11013041 AGGTAGAAGAACAGAAGAGAGGG - Intergenic
1186940478 X:14501466-14501488 AAGTACAAGCAAAGCAGGGAGGG - Intergenic
1186942784 X:14529224-14529246 AATTTGAAGCAGAAAAGGGAAGG - Intergenic
1187882864 X:23862824-23862846 AGGAAGAAGGAGGGAAGGGAAGG + Intronic
1188703675 X:33299424-33299446 AAATAGAAGCTAAGAAGGGAAGG - Intronic
1188705184 X:33319341-33319363 ATCCATAATCAGAGAAGGGAGGG + Intronic
1189731889 X:44029551-44029573 AAGTCGAAGCAGAGAGGCGACGG + Intergenic
1191800817 X:65077359-65077381 CAGTGGAAGCAGAGAAGGGCTGG - Intergenic
1192002415 X:67168110-67168132 TTGTATAAGCAGAGAAAGAAAGG - Intergenic
1192240048 X:69321546-69321568 AGGTAGAAGCAGAGCATGGGAGG + Intergenic
1192244860 X:69363615-69363637 AGCTTGGAGCAGAGAAGGGAGGG + Intergenic
1192967084 X:76189273-76189295 TTATAGAAGCAGAGAGTGGAAGG - Intergenic
1193431108 X:81407020-81407042 ATTTAGAAGCAGTTTAGGGAGGG + Intergenic
1194530372 X:95040482-95040504 ATATAGAAGAAGATATGGGAAGG - Intergenic
1194755158 X:97730746-97730768 ATGAAGAAGGACATAAGGGAGGG - Intergenic
1194762899 X:97815482-97815504 ATGAAATAGCAGAGAAAGGATGG + Intergenic
1196809496 X:119617757-119617779 ATGAAGGCCCAGAGAAGGGAAGG - Exonic
1197415573 X:126167655-126167677 ATATTGAGGCAGAGAAGGGGAGG - Intergenic
1197674209 X:129312429-129312451 ATGAAGAAGAAGGGCAGGGAGGG + Intergenic
1197899572 X:131355704-131355726 AGGGAAAAGCAGGGAAGGGAAGG - Intronic
1198323423 X:135542528-135542550 AGAGAGAAGGAGAGAAGGGAGGG + Intronic
1198525535 X:137496683-137496705 GAGTAGGAGCAGAGGAGGGATGG - Intergenic
1198916206 X:141675274-141675296 ATCAAGAGGCAGAAAAGGGAAGG - Intronic
1199084681 X:143615221-143615243 GTGTAAAAGCAGAGAGGGGTGGG - Intergenic
1199424022 X:147680435-147680457 CTGCAGGAGCAGAGTAGGGAGGG + Intergenic
1200944454 Y:8819706-8819728 ATCAAGAGGCAGAAAAGGGAAGG - Intergenic
1201894870 Y:18982535-18982557 ATGCAGTAGGAGAGCAGGGATGG - Intergenic
1202021599 Y:20470254-20470276 AGCTAGAAGCAGAAAGGGGAAGG - Intergenic