ID: 1028175918

View in Genome Browser
Species Human (GRCh38)
Location 7:87657897-87657919
Sequence CTCCCACAGGGGAAGGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 529
Summary {0: 1, 1: 0, 2: 3, 3: 47, 4: 478}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028175918_1028175925 9 Left 1028175918 7:87657897-87657919 CCTCCCACCTTCCCCTGTGGGAG 0: 1
1: 0
2: 3
3: 47
4: 478
Right 1028175925 7:87657929-87657951 AAAAAGCTAGTTAAAACAGAAGG 0: 1
1: 5
2: 12
3: 66
4: 463

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028175918 Original CRISPR CTCCCACAGGGGAAGGTGGG AGG (reversed) Intronic
900082575 1:869763-869785 CTGCCACGGGGGGAGGTGTGGGG - Intergenic
900102378 1:967378-967400 GTCCCACAGGGGCTGGGGGGGGG - Intronic
900505352 1:3027610-3027632 CTCCACCAGGGGCAGGCGGGGGG + Intergenic
900654140 1:3746883-3746905 GTCCCACAGGAGAAGGGGGAGGG + Intergenic
901004991 1:6167189-6167211 GTCCCCCCGGGGCAGGTGGGAGG + Intronic
901927119 1:12573290-12573312 CTCCCAAAGGAGGAGCTGGGAGG - Intronic
902822311 1:18950798-18950820 CTCCAAAAAGGGATGGTGGGTGG - Intronic
904481074 1:30793655-30793677 TTCCCACAGGCGTAGGTGGGGGG + Intergenic
904848000 1:33435266-33435288 CTCCCATGGGGAAAGGAGGGAGG - Intergenic
906062837 1:42959439-42959461 CTCACAAACGGGAATGTGGGGGG - Intergenic
906662174 1:47590719-47590741 CTGGTACATGGGAAGGTGGGAGG + Intergenic
907724603 1:57007494-57007516 CTCCCAGATGGGAGGGTAGGGGG + Intronic
908796990 1:67840015-67840037 CTCCCTCAGGGGAGGGTGCTGGG + Intergenic
909568999 1:77086848-77086870 CTTCCTCAGGGGATGGTGGCTGG + Intergenic
909940848 1:81610054-81610076 CTCCCCAAGAGGCAGGTGGGAGG - Intronic
911709122 1:101048902-101048924 CTCCAAAAGGGGGAGGTTGGAGG + Intergenic
912316892 1:108675481-108675503 CTCCCAGACGGGATGGTGGCCGG - Intergenic
912772379 1:112476627-112476649 CTCCCACAGGTGGAGGTTGTGGG - Intronic
912950318 1:114116262-114116284 CTGCCTCAGGGGAAGGAGGGAGG + Intronic
913688542 1:121256815-121256837 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
914040398 1:144044458-144044480 TTCAGTCAGGGGAAGGTGGGGGG + Intergenic
914149058 1:145023462-145023484 TTCAGTCAGGGGAAGGTGGGGGG - Intronic
915212312 1:154319498-154319520 CTCCCAAGGGGGAATCTGGGTGG + Intergenic
915529837 1:156497063-156497085 TTCCCAGTGGGGAAGCTGGGGGG - Intronic
915741036 1:158118499-158118521 CTCGAAGAGGGGAAGATGGGTGG - Intergenic
915940042 1:160113346-160113368 CTCTCACTGGGCAAGGAGGGTGG + Intergenic
916124441 1:161556782-161556804 CTCGGACAGGGGTAGGGGGGTGG + Intergenic
916134333 1:161638132-161638154 CTCGGACAGGGGTAGGGGGGTGG + Intronic
918724145 1:187895838-187895860 CTCTCAGAGGCCAAGGTGGGTGG - Intergenic
919223453 1:194661914-194661936 TGCCCACAGGAGAAAGTGGGAGG + Intergenic
920398183 1:205661274-205661296 CTGCCACAGGGGAAGGGGAAGGG + Intronic
920475864 1:206275314-206275336 TTCAGTCAGGGGAAGGTGGGGGG + Intronic
921262296 1:213395034-213395056 CTGCGGCAGGGGAAGGAGGGTGG - Intergenic
921686538 1:218095441-218095463 CTTCCACAGAGGTTGGTGGGTGG - Intergenic
922574410 1:226652501-226652523 CTCCCACAAGGGAGGGCTGGAGG - Intronic
922726088 1:227923706-227923728 CCCCCACAGACCAAGGTGGGAGG - Intronic
924582213 1:245332330-245332352 CTCCCAAGGGGGCAGGTGAGAGG + Intronic
1062760035 10:11300-11322 CTGCCACGGGGGGAGGTGGGGGG - Intergenic
1063420273 10:5906918-5906940 CTCCAGGTGGGGAAGGTGGGAGG - Intronic
1064197722 10:13259522-13259544 CTCCCACAGGGCAGTGGGGGGGG - Intergenic
1064642657 10:17430047-17430069 CTCAGAAAGGGGAAGATGGGAGG - Intronic
1064663409 10:17628870-17628892 CTCCCAGACGGGATGGTGGCCGG + Intergenic
1065829347 10:29600284-29600306 ATCACAAAGGGGAAGGTTGGAGG + Intronic
1066070448 10:31803799-31803821 CTCCCACAGGGCCGGGGGGGCGG - Intergenic
1066747597 10:38616353-38616375 CTGCCACGGGGGGAGGTGTGGGG - Intergenic
1067411446 10:46068361-46068383 GTCCCAAAGGGGGAAGTGGGTGG + Intergenic
1067427771 10:46222533-46222555 CTCCCACAGTGGAAGGGGTGAGG + Intergenic
1067734183 10:48836696-48836718 CTCCCACAGGGGACTGTGATGGG - Intronic
1069017584 10:63447737-63447759 CAACCATAGGGGAAGGTAGGTGG + Intronic
1069872680 10:71542812-71542834 CTCCCCCAGGGGAAGGGGTGGGG - Intronic
1069899005 10:71696290-71696312 CCCCCACAGGGCTGGGTGGGTGG - Intronic
1069959343 10:72070424-72070446 ATCCTACAGGAGAGGGTGGGGGG + Exonic
1070118625 10:73553521-73553543 CTCCCTCTGGGAAAGGTGGGAGG - Intronic
1070276551 10:75012853-75012875 CTCCCACAGTGGAAGATGTATGG - Intronic
1072455379 10:95570942-95570964 ACCCCATAGGGGAAAGTGGGTGG + Intergenic
1072752736 10:97994877-97994899 CTCACACAGGATAAGGTGGCCGG - Intronic
1074145101 10:110710638-110710660 CCCCCAAAGGGGAAGGGGGAGGG - Intronic
1074696122 10:116051502-116051524 ATGCCACAGGGGAAGGGGGCTGG + Intergenic
1075556135 10:123434000-123434022 ATCACCCAGGGGAGGGTGGGAGG + Intergenic
1075596735 10:123736971-123736993 TGCCCACTGCGGAAGGTGGGAGG - Intronic
1076511314 10:131015689-131015711 CTCACAAAGGGGAAGCTGGAGGG + Intergenic
1077107817 11:849615-849637 CTCCCGCGCGCGAAGGTGGGGGG + Intronic
1077192426 11:1260986-1261008 GTCCCCCTGGGGAGGGTGGGTGG + Intronic
1077211376 11:1372321-1372343 TTCCCACAGGGGAGGGAGGAAGG - Intergenic
1077491809 11:2864431-2864453 CACCCTGAGGGGAAGGTGGATGG - Intergenic
1078212398 11:9280179-9280201 CTTCCAGAGGCCAAGGTGGGTGG - Intergenic
1078357689 11:10644660-10644682 TTCTCACTGGGGAAGCTGGGGGG + Intronic
1078451783 11:11445954-11445976 CTCCCACAGGTGAGAGTGGGTGG + Intronic
1079028458 11:16967480-16967502 GCCACACAGGGGAAGGTGAGGGG + Intronic
1081618242 11:44603191-44603213 CTCACCCTGAGGAAGGTGGGGGG + Intronic
1083021834 11:59515592-59515614 CTCACACTGGGGAAGGCAGGAGG + Exonic
1083091279 11:60201579-60201601 CTCCCAGATGGGATGGTGGCCGG + Intronic
1083106361 11:60361908-60361930 CTACCTCTGGGGAAGGAGGGAGG + Intronic
1083292210 11:61696489-61696511 CTCCCACAGGGGAAGGGGAGGGG - Intronic
1083869838 11:65479921-65479943 CTCTCCCTGTGGAAGGTGGGGGG + Intergenic
1084274145 11:68043231-68043253 TGCCCACAGGGGAAGGCAGGAGG - Intronic
1084590093 11:70085388-70085410 GTCACAGAGGGCAAGGTGGGCGG + Intronic
1084764981 11:71302312-71302334 CTCGCACAGGGGATGCTGGAGGG - Intergenic
1085476746 11:76793951-76793973 CTTCCAGACTGGAAGGTGGGTGG - Intronic
1085708812 11:78810852-78810874 CACCCACTGGGGAAGGTGCCAGG + Intronic
1088653254 11:111976855-111976877 ACGCCAGAGGGGAAGGTGGGAGG + Intronic
1088655536 11:111995840-111995862 CTCAATCAGGGGTAGGTGGGAGG - Intronic
1089116458 11:116099171-116099193 CTCCTACTGGGGTAGGGGGGAGG - Intergenic
1089347146 11:117797592-117797614 CTCCTCCTGGGGAGGGTGGGGGG - Intronic
1090028247 11:123185636-123185658 CTCCCCCAGGGGAAGGCAGATGG + Intronic
1090078572 11:123595027-123595049 CACCCAAAGGGGAGGGAGGGAGG - Intronic
1090146377 11:124327605-124327627 CGGGCACAGAGGAAGGTGGGAGG + Intergenic
1090383525 11:126343403-126343425 CTCCACCAGGGGCAGGTGAGTGG + Exonic
1090947917 11:131448211-131448233 CTCACTCAGGGCAAGGTGGGAGG - Intronic
1090948107 11:131449321-131449343 CTCCCACAGGGGCATGGAGGTGG + Intronic
1091839095 12:3606371-3606393 GGCCCTCAGGGGAAGGAGGGTGG + Intergenic
1092113980 12:5985477-5985499 CTGCCAGAGGTGAAGATGGGTGG + Intronic
1092239289 12:6827558-6827580 CTCGCACAGGGAAGGCTGGGAGG + Intronic
1092453485 12:8624887-8624909 CTCCCAGACGGGATGGTGGCCGG - Intergenic
1092809960 12:12263597-12263619 CTCCGAGAGGCGGAGGTGGGAGG + Intronic
1093325035 12:17763368-17763390 CACCCACAGGTGTAGGTTGGAGG - Intergenic
1094043613 12:26143752-26143774 CCCCCACAGCAGGAGGTGGGCGG + Intronic
1094807587 12:34107727-34107749 CTGCCACGGGGGAAGGTGTGGGG - Intergenic
1096082647 12:48842771-48842793 CTCCCAGACGGGGTGGTGGGCGG - Intronic
1096116906 12:49060263-49060285 CTCCCCCCGGGGAAGGGAGGAGG + Intergenic
1096472927 12:51890243-51890265 CACCCTCTGGGGCAGGTGGGTGG - Intronic
1096628772 12:52912124-52912146 CTACCACAGGGCAAGGTCTGAGG + Intronic
1096828234 12:54295381-54295403 TTCCCTCAGGGGAAGCTGGAGGG - Exonic
1097241796 12:57580737-57580759 CTCCCAGAGCGAAGGGTGGGTGG - Intronic
1097254799 12:57665264-57665286 CTCCCAGAGGGGGTGGTGGCCGG - Intergenic
1097261871 12:57725080-57725102 CTCCCACTGGGGCTGGTGGCAGG - Intronic
1098421011 12:70297978-70298000 CTCCCAGAGGTTGAGGTGGGTGG - Intronic
1099317636 12:81104575-81104597 CTCCCACATGGCTGGGTGGGAGG - Intronic
1101489837 12:105200449-105200471 CCCACACAGGGGTAAGTGGGCGG + Intronic
1102089495 12:110173437-110173459 CTCCCAGACGGGATGGTGGCCGG - Intronic
1102523593 12:113494793-113494815 CTACCACAGGGGTTGTTGGGAGG - Intergenic
1102534248 12:113569092-113569114 CAGCCACTGGGGAAGGAGGGTGG - Intergenic
1103003161 12:117401514-117401536 CTCCCACAGGGGAAGTGCTGGGG + Intronic
1103642423 12:122362397-122362419 CTTCCAGAGGCCAAGGTGGGCGG + Intronic
1104131799 12:125901042-125901064 CTCCCAGAGGGGAATGTGGATGG - Intergenic
1104307338 12:127621563-127621585 CACCCCCAGGGGAAGGTGGCAGG + Intergenic
1104770901 12:131363693-131363715 CTCCCACAGGCGTGGGCGGGTGG - Intergenic
1105267321 13:18832884-18832906 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1105973455 13:25452263-25452285 ATGCCAGAGGGGAATGTGGGTGG - Intronic
1106566607 13:30890468-30890490 CCCCCCCAGTGGAAGGTGGTAGG - Intergenic
1106778341 13:33030036-33030058 CTCCCATGGTGGAAGGTGAGAGG + Intronic
1107012166 13:35680117-35680139 CTCCCCCAGGGGCAGACGGGTGG + Intergenic
1107890342 13:44908931-44908953 CTCCCCCAGGGCAAGGCGGGTGG - Intergenic
1108702427 13:52955061-52955083 CTCCCACAGAGCAACTTGGGGGG + Intergenic
1109627398 13:64993442-64993464 CTATCACGGGGGAGGGTGGGCGG + Intergenic
1110305771 13:73985034-73985056 TGCGCACTGGGGAAGGTGGGTGG - Intronic
1110313349 13:74076479-74076501 CCCACACAGTGGAAGGTGGAAGG + Intronic
1111535706 13:89600010-89600032 CTCCCAGAGGCTGAGGTGGGAGG + Intergenic
1111702690 13:91710912-91710934 CTCCTAGAGGGAAATGTGGGTGG + Intronic
1112402244 13:99086836-99086858 CCCTCACTGGGGAAGGTGGGGGG + Intergenic
1113408095 13:110060488-110060510 CTCCCTCAGGAGAAGATGGTGGG - Intergenic
1113793913 13:113045754-113045776 ATCCCACTGGGGAAGGGAGGCGG - Intronic
1113897450 13:113775396-113775418 CTTCCACAGGAGAAGGTGCGGGG - Intronic
1113904238 13:113811857-113811879 CTCCCCCGGGGGAAAGTAGGTGG - Exonic
1113908563 13:113831361-113831383 GTCCTACAGGGAAGGGTGGGCGG + Intronic
1114633382 14:24173517-24173539 CTCCCACAGGAGATGGTGCAGGG + Intronic
1114657101 14:24322790-24322812 CACCCACAGGGCAAAGTGGGAGG - Intronic
1115622249 14:35152451-35152473 CTCCCAGACGGGATGGTGGCCGG + Intronic
1117285637 14:54283242-54283264 CTCACACTGAGGAAGGTGGAGGG - Intergenic
1118576466 14:67246451-67246473 CAGCCACTGGGGAAAGTGGGAGG - Intronic
1119614650 14:76091157-76091179 CTGTCACAGGAAAAGGTGGGAGG + Intergenic
1119630353 14:76226684-76226706 CTCACACAGCGGATGGTGGAAGG - Intronic
1120044970 14:79795418-79795440 CTCCCACAGAGAAATGTGGGAGG - Intronic
1120508967 14:85389496-85389518 CTCCCATGGTGGAAGGTGGAAGG + Intergenic
1121441115 14:93949972-93949994 CTCTCACAGGGTAGGGTGGCTGG + Intronic
1122308704 14:100781243-100781265 CACCCAGAGGGGAGGGTGTGAGG + Intergenic
1122659153 14:103282824-103282846 CTCCCACTGGGGATGGAGGATGG + Intergenic
1122846561 14:104503270-104503292 CACTCACAGGGGAAGGTGAAGGG - Intronic
1123028791 14:105440940-105440962 CACCCACAGGGCAAGGAAGGTGG + Intronic
1123795085 15:23763143-23763165 CAGCCAAAGGGGAGGGTGGGGGG + Intergenic
1124668492 15:31615887-31615909 CTGGCACAGGGGCAGATGGGAGG + Intronic
1125351025 15:38767687-38767709 CTCTCACAGGGGAAAGCTGGAGG + Intergenic
1125360327 15:38857959-38857981 CTCCCAGGGAGGCAGGTGGGAGG - Intergenic
1125886452 15:43233408-43233430 CTCCCACTCAGGAAGCTGGGTGG - Intronic
1126833583 15:52635752-52635774 CTTTCACAGGCCAAGGTGGGTGG + Intronic
1126849810 15:52790103-52790125 GACGCAGAGGGGAAGGTGGGGGG - Intronic
1128312100 15:66637253-66637275 CTCCCACAGGGGTTGGGGGATGG + Intronic
1128779820 15:70351980-70352002 CTCCCCCACTAGAAGGTGGGAGG + Intergenic
1129297620 15:74608618-74608640 CTGGCCCAGGGGCAGGTGGGAGG - Intronic
1129797536 15:78389466-78389488 CTCCAGCTGGGGAAGGAGGGAGG + Intergenic
1130255711 15:82325185-82325207 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130255931 15:82326067-82326089 TTCCCTGAGGGGAAGGTGGCAGG + Intergenic
1130599251 15:85264801-85264823 TTCCCTGAGGGGAAGGTGGCAGG - Intergenic
1131023360 15:89118932-89118954 CTTCCATAGGAGGAGGTGGGTGG - Intronic
1131134834 15:89926345-89926367 CTCTGAGAGGTGAAGGTGGGAGG + Intergenic
1131494931 15:92900121-92900143 CCCCAACAGGGGGAGGGGGGAGG - Exonic
1131517505 15:93089006-93089028 CTGCCCCGGGGCAAGGTGGGAGG + Intronic
1132001107 15:98180952-98180974 CTCCCTCAAGGGATGGTGTGAGG - Intergenic
1132642561 16:984456-984478 CTCCCAGAGACCAAGGTGGGGGG - Intronic
1133654431 16:7846609-7846631 ATCCCCAAGGGGAAGATGGGAGG - Intergenic
1134817997 16:17222097-17222119 CTCCCTCAGAGGAACGTGAGTGG - Intronic
1136230523 16:28882985-28883007 CTCTCAAAGGGGAAGGAGCGAGG + Intronic
1137491524 16:48937114-48937136 CTTCCAGAGGCCAAGGTGGGAGG - Intergenic
1137560089 16:49496931-49496953 CACCCAGAGGGGAAGGGGGAGGG - Intronic
1137582709 16:49643552-49643574 CTCCCAAAGTGGGGGGTGGGGGG - Intronic
1137710731 16:50564898-50564920 CTCCAAAGGGGGAAGCTGGGAGG - Intronic
1137774383 16:51043235-51043257 TTGAGACAGGGGAAGGTGGGTGG - Intergenic
1137902745 16:52286848-52286870 CTACTAGAGGGGAAGGGGGGAGG + Intergenic
1138216444 16:55208818-55208840 CTCACCCAGGGGAATGTGAGAGG + Intergenic
1139653285 16:68373242-68373264 CTCCCACAGGGGACCCAGGGTGG - Intronic
1139844807 16:69912836-69912858 CTTCCAGAGGCCAAGGTGGGAGG + Intronic
1140420733 16:74816892-74816914 CTGCCACAGGCGAAGGGGTGGGG + Intergenic
1141046111 16:80717449-80717471 CTGCCACCAGGGAAGGTGGATGG + Intronic
1141551406 16:84809008-84809030 CACCCAGAGGGGATGCTGGGAGG + Intergenic
1141595247 16:85093243-85093265 CTCCCACAGGGGCTGGGGGTGGG + Exonic
1141703869 16:85654335-85654357 CTCCCTCAGGAGAAGGCAGGGGG + Exonic
1141716402 16:85729510-85729532 CCCCCACAGGGGAAGCTCAGAGG + Intronic
1141983159 16:87562255-87562277 CTCCCACAGGGGGCGGGGGGGGG - Intergenic
1142120669 16:88385107-88385129 TTCTCCCAGGGGAAGGTGGCAGG - Intergenic
1142398255 16:89845235-89845257 GTCCCCGAGGGGGAGGTGGGGGG + Intronic
1142743149 17:1942147-1942169 CTCCCCCAGGGAAAGCTTGGGGG - Intronic
1142759630 17:2035109-2035131 CACCCCCAGGGGAAGGATGGGGG + Intronic
1143367230 17:6416085-6416107 CTCCTCCAGGGTAAGGTGAGGGG - Intronic
1143780233 17:9225446-9225468 CCCCCACAGGGGCTGGCGGGGGG + Intronic
1143970557 17:10792235-10792257 CTCACACAGGGCAGGGAGGGAGG - Intergenic
1144623978 17:16835088-16835110 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1144882447 17:18437628-18437650 CTCCCAGAGGGGGATGTGGCAGG - Intergenic
1145149787 17:20506758-20506780 CTCCCAGAGGGGGATGTGGCAGG + Intergenic
1146260021 17:31415011-31415033 CTCCAGCAGGGGAAGCAGGGAGG + Intronic
1146688441 17:34856971-34856993 CTCACCCAGGAGAAGGTGGGGGG + Intergenic
1146688486 17:34857138-34857160 CTCACCCAGGAGAAGGTGGATGG + Intergenic
1147135912 17:38434210-38434232 CTCCTCCAGGAGAAGCTGGGGGG - Intronic
1148124295 17:45229053-45229075 CTACCACAGGGGCAGGGGGTGGG - Intronic
1148574720 17:48701938-48701960 CTCCTACAGAGGAAGGGTGGGGG + Intergenic
1149507250 17:57204476-57204498 CTCCCACAGCCAGAGGTGGGTGG + Intergenic
1150369583 17:64625170-64625192 CACCCAAAGGGGAAGGTGTGTGG - Intronic
1150497284 17:65617618-65617640 CTCCCACAGTGGTATGTGGAAGG + Intronic
1150503228 17:65671267-65671289 CTCCCGAAGGGGAAATTGGGAGG + Intronic
1151897505 17:76990251-76990273 CAGCCACAGGGTAAGGTGTGTGG + Intergenic
1152294822 17:79460773-79460795 CTCCCACGGTGGAAAGTGGAAGG - Intronic
1152581429 17:81166964-81166986 CTCCCACGGGGGCAGGCTGGGGG - Intergenic
1152952943 18:11653-11675 CTGCCACGGGGGGAGGTGGGGGG - Intergenic
1153607278 18:6847040-6847062 CTCCCACAGGAGGAGGTGATTGG + Intronic
1154139627 18:11811380-11811402 AGCTCACAGGGGAAGGTGGGTGG - Intronic
1154398933 18:14016674-14016696 CTCACACAGTGGAAGGTGGCAGG + Intergenic
1154421092 18:14228546-14228568 CTACAACAGGGGTAGGTGGAGGG - Intergenic
1154485513 18:14868631-14868653 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1155907447 18:31468878-31468900 ATCCCACGGTGGAAGGTGGAAGG - Intronic
1155942773 18:31816230-31816252 TTCCCCCAGGGCAAGGTTGGGGG + Intergenic
1156046618 18:32884768-32884790 TTCCCACAGGGGCTGGTGGAGGG + Intergenic
1156209538 18:34924471-34924493 ATCCCATGGTGGAAGGTGGGAGG + Intergenic
1157543479 18:48530494-48530516 ATCCCATAGTGGAAGGTGGAAGG + Intergenic
1157606954 18:48931905-48931927 CACCCTGGGGGGAAGGTGGGGGG + Intronic
1157688874 18:49664699-49664721 CTTCCCCAGAGGAAGGGGGGTGG - Intergenic
1157786025 18:50483370-50483392 CTCACATGGTGGAAGGTGGGAGG - Intergenic
1158618600 18:59010609-59010631 ATCCCGCAGTGGAAGGTGGAAGG + Intergenic
1160762285 19:791724-791746 CTCCCCCGGGGGGAGGGGGGAGG + Intergenic
1160768156 19:817843-817865 CGCCCACAGGTTAAAGTGGGTGG - Intronic
1161160295 19:2757877-2757899 CTCCTGCAGGGGAAGGTGAAGGG - Intronic
1161665342 19:5572703-5572725 CACTCTCCGGGGAAGGTGGGCGG + Intergenic
1161685054 19:5698457-5698479 CACCCAAAGGGTCAGGTGGGAGG + Intronic
1161713732 19:5864033-5864055 CTCCCCCAGGCCCAGGTGGGAGG - Intergenic
1161865373 19:6828957-6828979 CTCCTAGATGGGCAGGTGGGTGG + Intronic
1161964953 19:7542700-7542722 AGCCCGCAGGGGAAGGTGGCTGG + Intronic
1162013545 19:7831547-7831569 TTCCCACAGGGGTAGGTGCTGGG - Intronic
1162321652 19:9974143-9974165 CACTCCCAGAGGAAGGTGGGAGG - Intronic
1162577489 19:11507382-11507404 CTCCTACAGGCTGAGGTGGGAGG - Intronic
1162769934 19:12943325-12943347 CGCCCAGAGGCCAAGGTGGGCGG - Intronic
1162797903 19:13096020-13096042 CTCCCTCAAGGGAGGGTTGGGGG + Exonic
1162845274 19:13387539-13387561 GTCCCAGTGGGGAAGGTGAGTGG - Intronic
1163468752 19:17484923-17484945 CTGAAACAGGGGCAGGTGGGTGG + Intronic
1164680093 19:30128432-30128454 CTCCATGAGGGGACGGTGGGTGG - Intergenic
1166066992 19:40365920-40365942 GCCCCTCAGGGGTAGGTGGGGGG + Exonic
1166811167 19:45515411-45515433 CTCCCAGAGGGGCTGGTGGGAGG + Intronic
1167077098 19:47256731-47256753 CGCCCACATGGGAAGCTGGAGGG + Intronic
1167120799 19:47515267-47515289 CTTCCACAGGGTCACGTGGGAGG - Intergenic
1167561586 19:50229147-50229169 CTCCCACAAGGAAAGCTGGAAGG - Intronic
1168012024 19:53540721-53540743 CTCCCACAGGGCAGGCTCGGTGG - Intronic
1168320838 19:55508654-55508676 CATCCACAGGGGATGGGGGGAGG + Intronic
1168320860 19:55508728-55508750 CATCCACAGGGGATGGGGGGAGG + Intronic
1168320903 19:55508875-55508897 CATCCACAGGGGATGGGGGGAGG + Intronic
925172460 2:1758870-1758892 CTCCCACAGGGGAGGGAAGGGGG - Intergenic
925286506 2:2719557-2719579 CTCCCACTGTGGAAGGAGGTAGG + Intergenic
926767486 2:16334997-16335019 CTCCAACATGGGAAGCTGTGAGG + Intergenic
927936176 2:27078249-27078271 AGCCCAGAGGGGAGGGTGGGAGG - Intergenic
928451671 2:31383604-31383626 CTTGCACAGGGAAAGGCGGGAGG - Intronic
929443957 2:41988500-41988522 CTCCCACAGAGGCAGGCAGGCGG - Intergenic
930201450 2:48555247-48555269 CTCCCAGACGGGGAGGTGGCTGG + Intronic
930747456 2:54899632-54899654 CTCCCACAGGGGCACATGGAAGG + Exonic
932161726 2:69466245-69466267 CCCCCCCCGGGGAAGCTGGGAGG - Intronic
933764688 2:85698577-85698599 CTTCCACAGGACAAGGTGAGAGG - Exonic
933877017 2:86630129-86630151 CTAGCCCAGTGGAAGGTGGGAGG - Intronic
934497058 2:94812580-94812602 CTACAACAGGGGTAGGTGGAGGG + Intergenic
935402715 2:102677278-102677300 TTCCCCCTGGGGAGGGTGGGTGG - Intronic
935732294 2:106074073-106074095 CTTCCACAGGGAAGGGTGGCAGG + Intronic
935944074 2:108270224-108270246 CTTCCAGATGGGAAGGTGGGTGG - Intergenic
936024723 2:109022325-109022347 CTCCCCCTGGGGAAGGTAGATGG - Intergenic
936093139 2:109513701-109513723 GTGCCACAAGGGAAGGAGGGAGG + Intergenic
937078648 2:119125088-119125110 CTCCCACAGGTGCATGTGGCTGG - Intergenic
937698531 2:124837015-124837037 CTCTCACAGGGGAAGATGAGAGG - Intronic
938496825 2:131802090-131802112 CTGCCACGGGGGGAGGTGTGGGG + Intergenic
938969647 2:136420513-136420535 CTCCCAGAGTGGAAGCTGGAGGG - Intergenic
941603010 2:167563664-167563686 CTCCCTCCGGGGGAGGTGGGGGG - Intergenic
943122076 2:183749022-183749044 TTCCCACAGAGAAAGGTGGCAGG + Intergenic
943703637 2:191013006-191013028 CCCCGGCGGGGGAAGGTGGGTGG + Intronic
943971813 2:194419370-194419392 CTCACACAGTGGAAGGTGGAAGG - Intergenic
944088180 2:195873403-195873425 CTCCCACACTGGGAGGTGGCAGG + Intronic
944576119 2:201092545-201092567 CTCCAAGAGGCCAAGGTGGGTGG + Intergenic
945031807 2:205672074-205672096 GCCCCATTGGGGAAGGTGGGAGG + Intergenic
945533358 2:210983369-210983391 CACACACCGGGGAAGGTTGGGGG - Intergenic
946056811 2:216909993-216910015 CTCCCAGCAGGGATGGTGGGAGG - Intergenic
946077965 2:217091534-217091556 CTGTCACAGGGGAACGTGGCAGG - Intergenic
946332820 2:219019756-219019778 CCCCCTCCAGGGAAGGTGGGAGG - Intronic
947573068 2:231250558-231250580 CTCCCAGAGGGGAGGGTAGACGG + Intronic
947798003 2:232906316-232906338 CTCCCACACGGGGTGGTGGCCGG - Intronic
947798081 2:232906492-232906514 CTCCCACACGGGGTGGTGGCCGG - Intronic
948034484 2:234847148-234847170 ATCCCACAGGGGATGGAGAGAGG + Intergenic
948075779 2:235164171-235164193 TTCTCAAGGGGGAAGGTGGGGGG + Intergenic
948110876 2:235454838-235454860 CTCTTACAGGGGAAAGGGGGAGG + Intergenic
948387192 2:237588267-237588289 ATCCCACAGTGGAAGGTGAAAGG - Intronic
948895810 2:240926356-240926378 CTCCCACAGGGGCTGGTGCCTGG - Intronic
1168846289 20:946914-946936 GTCCCACTGGGGAGGGTGGCTGG + Intergenic
1169431368 20:5539280-5539302 CTTTCAGAGGGGAAGGTGGGTGG + Intergenic
1169657599 20:7942443-7942465 CTCCTACAGGTGTAGGTGGTTGG - Intergenic
1170645808 20:18194849-18194871 CTCCCACACGGGGTGGTGGCCGG - Intergenic
1170701605 20:18708822-18708844 CCACCACGGGGGCAGGTGGGAGG - Intronic
1171343782 20:24450685-24450707 ATTCCTCAGAGGAAGGTGGGTGG + Intergenic
1171489772 20:25508652-25508674 CTACAACAGGGGGAGCTGGGGGG + Intronic
1171726257 20:28623891-28623913 CTCACATGGTGGAAGGTGGGAGG + Intergenic
1171888353 20:30679361-30679383 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1172182979 20:33014884-33014906 CTCCCTGGGGGGGAGGTGGGAGG - Intronic
1173637833 20:44576577-44576599 CTCCAACAGGAGAAGGTTTGAGG - Intronic
1175191833 20:57216708-57216730 CCCACATAGGGGAAGGTGTGTGG + Intronic
1175240680 20:57546011-57546033 CTCCCACAAGGGCTGGTGTGTGG + Intergenic
1175875683 20:62228198-62228220 CACCCATAGGGGAAGGTGCCGGG - Intergenic
1176171362 20:63697779-63697801 CTGCCCGAGGGGAAGGTGGCTGG + Intronic
1176387578 21:6146482-6146504 CTCCCACAGAGAGAGGGGGGTGG - Intergenic
1176795823 21:13370846-13370868 CTTCCACAGGGGAAACTAGGTGG + Intergenic
1176852383 21:13931415-13931437 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1178034479 21:28564262-28564284 CTCCCAGAGGGGGTGGTGGCCGG - Intergenic
1178437710 21:32574521-32574543 CTCCCTCAGGGGAACCTGGCGGG + Intergenic
1178921083 21:36738680-36738702 CTACAACAGTGGGAGGTGGGAGG - Intronic
1179479175 21:41666875-41666897 GGCCCACAGGGGATGGTGGAGGG - Intergenic
1179492600 21:41751062-41751084 CACCCACAGGGGATGGGGGGCGG + Intronic
1179735894 21:43391766-43391788 CTCCCACAGAGAGAGGGGGGTGG + Intergenic
1179959990 21:44762750-44762772 CTCCCACAGGGGCTGCTGAGAGG - Intergenic
1180024065 21:45148572-45148594 CGCCCACAGGGGAAGCTTGGAGG + Intronic
1180289504 22:10784076-10784098 CTTCCACAGGGGAAACTAGGTGG + Intergenic
1180305395 22:11068723-11068745 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1181598955 22:23937367-23937389 CTCCCAGAGGGGGTGGTGGCCGG - Intergenic
1181617487 22:24065037-24065059 CTCCCAGAGGGGGTGGTGGCCGG + Intronic
1181990717 22:26834814-26834836 CTCCAACAGGTGGAGGTAGGGGG - Intergenic
1182114623 22:27748961-27748983 CTCCCACAGCCCATGGTGGGGGG + Exonic
1183315523 22:37135043-37135065 CAACCCGAGGGGAAGGTGGGAGG - Intronic
1183929909 22:41229998-41230020 CTCCCAGAAGGGAAGCTGGAGGG + Intronic
1184038253 22:41928683-41928705 CTGCCACAGGGGATGCTGGGAGG + Intergenic
1184164041 22:42717035-42717057 CGGGCACAGGGGAAGGTGTGTGG + Intronic
1184223724 22:43116963-43116985 CTCTCACAGGGGAATCTTGGGGG + Intronic
1184437236 22:44486634-44486656 GTTCCACAGAGGAAGGTGCGTGG + Intergenic
1185039510 22:48497211-48497233 CGCCCATACGGGAAGGAGGGAGG - Intronic
1185116714 22:48942089-48942111 CTCCCAGAGGAGCAGGTGGGAGG + Intergenic
1185394234 22:50578541-50578563 TTCCCACCGCGGAAGGTGGGTGG - Exonic
950040104 3:9914836-9914858 CTCAGACAGGGGAGGGTGAGGGG - Intronic
951693463 3:25421045-25421067 CTTCCACAGGGGCAGCAGGGTGG + Intronic
952543341 3:34391730-34391752 CTCCAAATGGGGAATGTGGGAGG + Intergenic
953417025 3:42728391-42728413 CTTGCACAGGGGAGGGTGGGGGG - Intronic
953744934 3:45567034-45567056 CTCCCACAGTGGAAGGTTGGAGG + Intronic
953905131 3:46864838-46864860 CTGCCACTTGGGGAGGTGGGAGG + Intronic
954680755 3:52344702-52344724 ATCCTGGAGGGGAAGGTGGGAGG - Intronic
954721029 3:52563269-52563291 CCCCCACAGGTGAAGGTGACAGG - Intronic
955679154 3:61482076-61482098 CTCCCAGAGGCTGAGGTGGGAGG + Intergenic
957132767 3:76243335-76243357 CTCCCTCAGGGAATGGAGGGTGG + Intronic
957935579 3:86937457-86937479 TTCCCACTGGAAAAGGTGGGTGG - Intergenic
958548561 3:95588623-95588645 AGCCCACAGGGGAAGCTGGGGGG + Intergenic
960125328 3:113992255-113992277 CTCCCACGGAGGAAAGTGAGAGG + Intronic
960142739 3:114166518-114166540 ATCCCATGGTGGAAGGTGGGAGG - Intronic
960969086 3:123126335-123126357 CTCCCACAGCGGGGGATGGGGGG - Intronic
961200796 3:125043768-125043790 CACCCAGAGAGGAAGCTGGGTGG + Intronic
961230808 3:125306611-125306633 TTCCCACAGGCTGAGGTGGGAGG + Intronic
961373979 3:126450384-126450406 CTCTAACAGGGGAGGGTGCGTGG - Intronic
961954493 3:130787546-130787568 CACCCGCAGGAGAAGGAGGGTGG + Intergenic
962207563 3:133447495-133447517 CTACCTCAGGGGAAGCTGGCAGG + Intronic
962411450 3:135144654-135144676 GTGCCAAAGGGGAATGTGGGGGG - Intronic
964703068 3:159590330-159590352 CTTTCAGAGGCGAAGGTGGGAGG + Intronic
965427616 3:168546725-168546747 CTCCCAGAGGCTAAGGTGGGAGG - Intergenic
966250593 3:177860645-177860667 CTCCCCCAAGCCAAGGTGGGTGG - Intergenic
968232243 3:197010909-197010931 CTTCCCCTGGGGAATGTGGGTGG + Intronic
969148098 4:5141817-5141839 ATCCCACTGAGGAAGGTGGAGGG - Intronic
969167478 4:5329498-5329520 CTCTAGCAGGTGAAGGTGGGTGG - Intronic
969581869 4:8070652-8070674 CTGCCACAGGGGAGGCTGGCAGG - Intronic
970534187 4:17012370-17012392 CTACCAGAGTGGAGGGTGGGAGG - Intergenic
971594737 4:28514715-28514737 CTCCCAGACGGGGTGGTGGGCGG + Intergenic
972279696 4:37590305-37590327 CTCCCACAGGGGGACGCTGGAGG + Exonic
973605593 4:52584198-52584220 CTTCCACAGTGGAAGATGGAAGG - Intergenic
974846215 4:67353513-67353535 CTCCCATAGCAGAAGGTGGAAGG + Intergenic
975902680 4:79171352-79171374 ATCCCACAGTGAAAGGTGGAAGG - Intergenic
976104689 4:81604172-81604194 CTCCCATGGTGGAAGGTGTGAGG - Intronic
978819065 4:112944580-112944602 GTCCCAATGGGGAAGGGGGGTGG - Intronic
980340963 4:131546996-131547018 CTTCCGGAGGGCAAGGTGGGAGG + Intergenic
981554735 4:145980564-145980586 ATGACAGAGGGGAAGGTGGGGGG + Intergenic
983131028 4:164020553-164020575 CTCCCTCTGGAGAAGGTGTGGGG - Intronic
983228319 4:165105953-165105975 CTCACGCAGTGGAAGGTGGAAGG - Intronic
983397600 4:167220627-167220649 CTTCCAGAGGCCAAGGTGGGAGG - Intronic
984721310 4:182975626-182975648 CATCCACCGCGGAAGGTGGGGGG - Intergenic
984791570 4:183619582-183619604 CTCCTGCAGGGGGAGGGGGGAGG + Intergenic
985347657 4:189023591-189023613 CTCCAGCAGGCCAAGGTGGGCGG + Intergenic
985434270 4:189913810-189913832 CTCACATGGTGGAAGGTGGGAGG - Intergenic
985509258 5:302966-302988 CTTCCCAAGGGGAAGTTGGGAGG + Intronic
985733351 5:1563816-1563838 CCTCCACAAGGAAAGGTGGGGGG - Intergenic
985739013 5:1603926-1603948 CTTCCCAAGGGGAAGTTGGGAGG - Intergenic
985838205 5:2285978-2286000 CTACCATGGGGGAAGCTGGGTGG - Intergenic
986782911 5:11083833-11083855 CCCCCATGGGGGAAGGGGGGTGG - Intronic
990286090 5:54302091-54302113 CTCCCACTGGGAAAGTTGTGTGG - Intronic
990988749 5:61664640-61664662 TTCCAAATGGGGAAGGTGGGTGG + Intronic
992391729 5:76336321-76336343 CTCCCAGAGGGGATGGCGGCTGG + Intronic
993500384 5:88660403-88660425 CTCCCTGCGGGGAAGCTGGGTGG - Intergenic
993633645 5:90317943-90317965 CTGTCACTGGGGAAGGGGGGTGG + Intergenic
994388678 5:99163531-99163553 CTCAGAAATGGGAAGGTGGGAGG + Intergenic
995347088 5:111133448-111133470 CTCCCTGAGGGGAATGAGGGAGG + Intergenic
995508189 5:112882013-112882035 CTTCCAGAGGTCAAGGTGGGTGG - Intronic
995679931 5:114704731-114704753 CTCCCACAGTGCAGTGTGGGGGG + Intergenic
997129524 5:131263632-131263654 CGCGCACAGGCGAGGGTGGGTGG - Intronic
997242158 5:132315472-132315494 CTCACACAGGGGAGGCTTGGAGG - Intronic
997916724 5:137934162-137934184 CTACCACAAGGGAAGGTGGTAGG + Intronic
998099211 5:139418009-139418031 CTGCCACAGAGGAAGATGTGGGG + Intronic
998460563 5:142307051-142307073 CTCCCACTGGGCATGGTGGAGGG - Intergenic
999937295 5:156501177-156501199 CTCCCACTGGGATGGGTGGGGGG - Intronic
1000005030 5:157175559-157175581 AGCCCACAGGGGAAGGTGGGTGG + Intronic
1001092174 5:168749660-168749682 CTCCCACAGTAGAAGGATGGAGG - Intronic
1002724297 5:181284067-181284089 CTTCCACAGGGGAAACTAGGTGG - Intergenic
1002929838 6:1625434-1625456 CTGCCAGAGGGGACGGTGGCGGG - Intronic
1003571410 6:7258704-7258726 GTCCCACTGGGGAAGTCGGGAGG + Intergenic
1003945297 6:11070094-11070116 CACCCACAGTGGAAGCTGGAAGG + Intergenic
1004034725 6:11912442-11912464 CTCACACAGCAGGAGGTGGGTGG + Intergenic
1004249893 6:14015205-14015227 CTCACATAGTGGAAGGTGGAAGG + Intergenic
1004479043 6:16001306-16001328 CTCCCACTGGGAAGGGTGGCAGG + Intergenic
1004816851 6:19320388-19320410 CTCCCACAGAGAAGGATGGGAGG + Intergenic
1006264168 6:32903348-32903370 ATCACACAGAGGAAGGTGGAAGG - Intergenic
1006391207 6:33759941-33759963 CTTCAGCAGGGCAAGGTGGGGGG - Intergenic
1006581358 6:35079496-35079518 CACCTACAGGGCAAGGAGGGAGG - Exonic
1006582255 6:35083851-35083873 CCCCCACCCTGGAAGGTGGGAGG + Intronic
1006836157 6:36999947-36999969 CTCAGATGGGGGAAGGTGGGAGG - Intergenic
1006836417 6:37001675-37001697 CTCAGATGGGGGAAGGTGGGAGG + Intergenic
1007784838 6:44273582-44273604 CTCCCTGGGGGGAAGGTGGGAGG + Intronic
1008730440 6:54475688-54475710 CTCAGAAAGGGGAAAGTGGGAGG + Intergenic
1012278749 6:97303579-97303601 CTTCCACAGTAGAAGGTGGGAGG - Intergenic
1012891991 6:104907517-104907539 CTGCCACTGGGGAATGGGGGAGG - Intergenic
1013154262 6:107477983-107478005 CTACCTGAGGGGGAGGTGGGAGG + Intergenic
1013212924 6:108002809-108002831 CTCCCTATGGGGAAGGAGGGAGG - Intergenic
1015636269 6:135277808-135277830 CTCAGAAGGGGGAAGGTGGGAGG + Intergenic
1017163490 6:151388289-151388311 TTCCTACAGGGAAAGGTGAGTGG + Intronic
1017469098 6:154722026-154722048 CTTCCAGAGGTCAAGGTGGGAGG + Intergenic
1017642749 6:156510184-156510206 CTCCAAAGGGGTAAGGTGGGTGG - Intergenic
1017839727 6:158211266-158211288 CTTCCAGAGGCCAAGGTGGGTGG - Intergenic
1018030028 6:159834351-159834373 CTGCCACAGGAAATGGTGGGGGG - Intergenic
1018554895 6:165038808-165038830 TTTCCACAGGGACAGGTGGGAGG + Intergenic
1019155787 6:170038059-170038081 CTGTCACAGGGGAGGGTGTGGGG + Intergenic
1019163169 6:170082302-170082324 ACCCCACAGCAGAAGGTGGGAGG - Intergenic
1019234350 6:170597203-170597225 CTACCAGAGGCTAAGGTGGGAGG + Intergenic
1019320864 7:414663-414685 CTCACACATGGGGTGGTGGGTGG - Intergenic
1019325415 7:436065-436087 CTCCCAGAGGGCCAGGTGGACGG - Intergenic
1019337210 7:491140-491162 CTCCCTCAGGGGACTCTGGGAGG - Intergenic
1019373596 7:676824-676846 CTCCCCGAGGGCAAGGAGGGTGG + Intronic
1019373618 7:676882-676904 CTCCCGGAGGGCAAGGAGGGCGG + Intronic
1019373639 7:676940-676962 CTCCCGGAGGGCAAGGAGGGTGG + Intronic
1019373660 7:676998-677020 CTCCCGGAGGGCAAGGAGGGCGG + Intronic
1019412501 7:912373-912395 CACCCCCAGGGGCAGGCGGGGGG + Intronic
1019800831 7:3087236-3087258 ATTCCACAGGGGAAGGTGTGGGG - Intergenic
1019898780 7:4003358-4003380 GTGTCACAGGGGAAGCTGGGTGG - Intronic
1020103162 7:5406993-5407015 GTCCCACAGCGGGAGGTGAGGGG - Intronic
1020634113 7:10675449-10675471 CTCCCCCAGGGTCACGTGGGTGG - Intergenic
1021024138 7:15643472-15643494 CTCCCATAGGGGAACAGGGGTGG + Intronic
1021539788 7:21744754-21744776 CCCACACATGGGTAGGTGGGTGG - Intronic
1022216930 7:28272551-28272573 CTCCCCCAGAGGAAGGAGGAAGG - Intergenic
1022616469 7:31935980-31936002 TTCCCACAGGGGAACATAGGAGG + Intronic
1024202951 7:47125127-47125149 CTTGCAGAGAGGAAGGTGGGAGG - Intergenic
1025184981 7:56850650-56850672 CTCCCAGAGGGGAAAGAGTGTGG - Intergenic
1025686953 7:63726314-63726336 CTCCCAGAGGGGAAAGAGTGTGG + Intergenic
1026503259 7:70960580-70960602 CTGCCAGAGGAGAAGGAGGGTGG + Intergenic
1028175918 7:87657897-87657919 CTCCCACAGGGGAAGGTGGGAGG - Intronic
1029044259 7:97611442-97611464 CTCACATAGTGGGAGGTGGGAGG + Intergenic
1029745910 7:102515848-102515870 AAGCCACAGGGGAAGATGGGGGG + Intronic
1029763848 7:102614827-102614849 AAGCCACAGGGGAAGATGGGGGG + Intronic
1031234476 7:119156397-119156419 CTCTCAGAGTGGAGGGTGGGAGG + Intergenic
1032131831 7:129235529-129235551 CCTCCACAGGGTGAGGTGGGAGG - Intronic
1032193094 7:129775527-129775549 CTGCCACAGGGCAGGCTGGGGGG - Intergenic
1032321043 7:130887107-130887129 CCCTCACAGGGGAAAGTGGTGGG - Intergenic
1032938422 7:136760864-136760886 CTACCACAGTGGAAGGTGAAGGG - Intergenic
1032966971 7:137108885-137108907 CCCCAAAATGGGAAGGTGGGAGG - Intergenic
1034900622 7:154906015-154906037 CTCCCCCAGGGGATGGGGCGGGG + Intergenic
1035170757 7:157016211-157016233 CTCCCACTAGGGTGGGTGGGGGG - Intergenic
1035194164 7:157201470-157201492 CAGCCACAGGGGAGGGAGGGCGG + Intronic
1035235677 7:157496408-157496430 TTCCAACAGGGGAAGGGGGAAGG + Intergenic
1035554744 8:558327-558349 ATCCCATGGTGGAAGGTGGGGGG + Intergenic
1035570197 8:667539-667561 CTACCACTGGGGAAGGCTGGTGG - Intronic
1035680698 8:1485625-1485647 TTCCCACAGTGGGAGCTGGGAGG - Intergenic
1037562310 8:20086048-20086070 CTGCCACAGGGGACACTGGGAGG + Intergenic
1038804658 8:30779065-30779087 CTCCAACTGGGGAAGGGGTGAGG + Intronic
1039468093 8:37797668-37797690 CCCCCAGAGGGGAAGATTGGAGG + Intronic
1040570650 8:48606136-48606158 CTCCCACAGGGGAAGAGGGCAGG - Intergenic
1040684659 8:49857291-49857313 CTCCCACCTGGAAAGGGGGGTGG + Intergenic
1042562958 8:70087159-70087181 ATCCCACAGGGCAATGTGGAGGG + Intergenic
1042852099 8:73226577-73226599 TTCCCAGGTGGGAAGGTGGGAGG - Intergenic
1045842741 8:106598501-106598523 CTTCCACAGAGGAAGCAGGGAGG - Intronic
1046970465 8:120217115-120217137 CTGCCACAGGGGATGGGGGTGGG + Intronic
1046973416 8:120247683-120247705 CTTTCACCGGGGAAGATGGGGGG - Exonic
1048323724 8:133422576-133422598 CTCCCACAGAGGAAAGGAGGTGG + Intergenic
1048929019 8:139296186-139296208 CTCACACAGTGGAAGGGGTGAGG - Intergenic
1049246093 8:141563329-141563351 CTCCCACAGGGAAACGTGCCTGG + Intergenic
1049481557 8:142826894-142826916 CTCCCAGAGGGGATGGTGGCCGG + Intergenic
1049643018 8:143723825-143723847 CCCCCACAGGGGTGGGTGGTGGG + Intergenic
1051617119 9:19016938-19016960 GCCTCACAGAGGAAGGTGGGTGG - Intronic
1052942165 9:34138213-34138235 CTCCCAGACGGGGAGGTGGCCGG - Intergenic
1053158493 9:35796773-35796795 CTTCCCCATTGGAAGGTGGGGGG - Intronic
1053660091 9:40267890-40267912 CTACAACAGGGGTAGGTGGAGGG - Intronic
1053910465 9:42897245-42897267 CTACTACAGGGGTAGGTGGAGGG - Intergenic
1054372224 9:64414194-64414216 CTACAACAGGGGTAGGTGGAGGG - Intergenic
1054524507 9:66108327-66108349 CTACAACAGGGGTAGGTGGAGGG + Intronic
1054679842 9:67903891-67903913 CTACAACAGGGGTAGGTGGAGGG - Intergenic
1054925397 9:70583902-70583924 ATAGCCCAGGGGAAGGTGGGTGG - Intronic
1055340088 9:75272396-75272418 CTCAGAAGGGGGAAGGTGGGAGG - Intergenic
1056007134 9:82284882-82284904 CTGCCTCGGGGGAAGGTGGGTGG - Intergenic
1056168332 9:83959342-83959364 CTCCCAGAGGCTGAGGTGGGAGG + Intergenic
1056395364 9:86176536-86176558 CTTCCACTGGGGAAGGCGGTGGG - Intergenic
1056409661 9:86312586-86312608 CTCCCAGATGGGATGGTGGCCGG - Intronic
1056770383 9:89474140-89474162 CAACCAAAGGGGGAGGTGGGAGG - Intronic
1057141268 9:92728084-92728106 CATCCACTGGGGCAGGTGGGAGG - Intronic
1057202281 9:93147997-93148019 CACCCACAGTGGGAGGTGAGGGG + Intergenic
1057258372 9:93568803-93568825 CTCCCAGTGGGGAAGGGTGGGGG + Intergenic
1057293910 9:93824540-93824562 CTCCCTCACCGGCAGGTGGGTGG - Intergenic
1057339542 9:94187556-94187578 CTCACATAGTGGAAGGTGGAAGG + Intergenic
1058917989 9:109586061-109586083 ATTCCACATGGCAAGGTGGGAGG - Intergenic
1061237106 9:129349586-129349608 CTTCTTCAGGGGAGGGTGGGTGG + Intergenic
1061442292 9:130614068-130614090 GTCCCACAGGGGAAGCTAGAAGG - Intronic
1061485105 9:130916533-130916555 CCCCCACACGGGAAGCTGGGAGG - Intronic
1061527564 9:131179438-131179460 TTGCCACAGGGGATGGTGGTTGG - Intronic
1061587699 9:131579306-131579328 CTCCCACAGAGGAAGGAGGCAGG + Exonic
1062311279 9:135938797-135938819 CTGGCACGGGGGATGGTGGGGGG + Intronic
1062393295 9:136342553-136342575 CTCCCACAGCGGCAGCCGGGCGG - Intronic
1203451790 Un_GL000219v1:124009-124031 CTCACATAGTGGAAGGCGGGAGG + Intergenic
1203557959 Un_KI270744v1:17235-17257 CTACAACAGGGGTAGGTGGAGGG + Intergenic
1186652569 X:11577039-11577061 CTCTCATAGGTGAAGGAGGGAGG - Intronic
1187342862 X:18436788-18436810 CTCCCAGAGAGTAAGCTGGGAGG + Intronic
1187788826 X:22925053-22925075 GTCCCACAGTGGAGGGTGGAAGG - Intergenic
1188158744 X:26774973-26774995 CTCAGAAAGGGGAAGGTGGGAGG + Intergenic
1189288064 X:39866187-39866209 TTCCCACAGGGGAACCTGTGTGG - Intergenic
1190296311 X:49029858-49029880 GTCCCACAGGGGCAGGGGTGAGG + Exonic
1190399204 X:50014722-50014744 CTATGACAGGGGAGGGTGGGAGG - Intronic
1191105966 X:56772581-56772603 TTCACACAGGAGAGGGTGGGAGG - Intergenic
1191106959 X:56777983-56778005 TTCACACAGGAGAGGGTGGGAGG - Intergenic
1192200317 X:69062373-69062395 GTCCCACAGGCAAAGCTGGGAGG - Intergenic
1193132173 X:77931534-77931556 CTCCCAGAGGGGGTGGTGGCCGG + Intronic
1193782763 X:85723758-85723780 CTCCCACACGGGGTGGTGGCCGG + Intergenic
1197110752 X:122771520-122771542 CTACTGCTGGGGAAGGTGGGAGG - Intergenic
1197976304 X:132169219-132169241 CACACACAGGAGAAGATGGGGGG - Intergenic
1198146204 X:133859907-133859929 CACCCACAGTGGAAGGTGAAGGG + Intronic
1198212579 X:134529737-134529759 CTCAAACCGGGGAAGGAGGGTGG - Intergenic
1199831358 X:151551631-151551653 CTCCCACAGTGCACGGGGGGGGG + Intergenic
1200238841 X:154483157-154483179 CTCCCTGAGGGGCAGGTGGTGGG + Intergenic