ID: 1028187891

View in Genome Browser
Species Human (GRCh38)
Location 7:87810366-87810388
Sequence GTGTGATTAGTTTGCTGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028187890_1028187891 -9 Left 1028187890 7:87810352-87810374 CCTTATTTAGCATGGTGTGATTA 0: 1
1: 0
2: 8
3: 187
4: 1109
Right 1028187891 7:87810366-87810388 GTGTGATTAGTTTGCTGCCTAGG 0: 1
1: 0
2: 0
3: 11
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028187891 Original CRISPR GTGTGATTAGTTTGCTGCCT AGG Intronic
902678032 1:18022609-18022631 GTGTGATAATTTTTCTGCTTAGG + Intergenic
905859648 1:41341768-41341790 GGGTGAATGGTTTGCTGCATAGG + Intergenic
912693859 1:111825359-111825381 CAGAGATTAGTGTGCTGCCTGGG - Intronic
916398582 1:164420132-164420154 GTCTGATCAGTTGGCAGCCTGGG - Intergenic
917110643 1:171543874-171543896 ATGTGATAAGCATGCTGCCTTGG - Intronic
920995029 1:210981922-210981944 GTGTGTTAAGTTTGATGCATAGG + Intronic
921602231 1:217118578-217118600 GTGTGATTTATTTTCTTCCTTGG - Intronic
922889389 1:229048478-229048500 TTGTGACTAGTTTTCTTCCTTGG + Intergenic
922891628 1:229066298-229066320 GTTTGATTAATTTGCTGAATTGG + Intergenic
1064090051 10:12375539-12375561 ATGTCATTAGGATGCTGCCTTGG + Intronic
1068658186 10:59595734-59595756 TTGAGGTTGGTTTGCTGCCTGGG + Intergenic
1070092878 10:73305850-73305872 GTGTAGTAAGTTTGATGCCTGGG - Intronic
1071240567 10:83700509-83700531 GTGATATTAGTTTGCAGGCTGGG - Intergenic
1071901936 10:90129847-90129869 CTGTGATGAGTTTGGTTCCTTGG - Intergenic
1074432492 10:113405719-113405741 ATGTGATTATTGTTCTGCCTGGG - Intergenic
1077370798 11:2180715-2180737 ATGTGATTACTTTGGGGCCTGGG + Intergenic
1077371218 11:2182457-2182479 GTGCGATTACTTTGGGGCCTGGG + Intergenic
1078594912 11:12677323-12677345 GTGTAATTAGTTTGCTGCTGGGG - Intronic
1085900210 11:80689882-80689904 GCCTGATTTGTTTTCTGCCTAGG + Intergenic
1087245205 11:95827027-95827049 GTGAGTTTGGTGTGCTGCCTAGG + Intronic
1087619051 11:100521505-100521527 ATGAGATTAGTTTGATTCCTAGG - Intergenic
1088495357 11:110426537-110426559 GAGTGATTGGTTTGCATCCTGGG + Intergenic
1089297166 11:117476718-117476740 GTATTATTACTCTGCTGCCTGGG + Intronic
1090797166 11:130145173-130145195 GGGTGTTTGGTTTGTTGCCTTGG + Intergenic
1094742294 12:33303517-33303539 GTTTGATTAGTTTGCTGGAGTGG - Intergenic
1097145352 12:56936019-56936041 GTGTGTTTAGTTTGAGGCCAGGG - Intergenic
1097280335 12:57841574-57841596 ATGTGATTTGTTATCTGCCTGGG - Intronic
1100497949 12:95143484-95143506 GTGTGAGTAGTTGGCTCCTTTGG - Intronic
1105710455 13:23003115-23003137 GTTTGATTACTTTTCTTCCTTGG + Intergenic
1105979405 13:25503070-25503092 GTGGGATCAGTGTGCTGCCTGGG + Intronic
1110253963 13:73410897-73410919 ATGTGATTATTTTGATGACTTGG - Intergenic
1112858018 13:103794626-103794648 ATGTGATTATTTTCATGCCTAGG + Intergenic
1117060091 14:51953524-51953546 GTGTGAGTAGTTGCCTTCCTAGG + Intronic
1118688779 14:68318052-68318074 ATGTGATTAGTTTTCTTCTTTGG + Intronic
1124827836 15:33116361-33116383 GTTTGAACAGTTGGCTGCCTCGG - Intronic
1124893717 15:33756943-33756965 GGGTGATACGTTTTCTGCCTGGG + Intronic
1125539807 15:40463839-40463861 GTGTCATTGGTTTGTTGCCTAGG + Exonic
1125607485 15:40949425-40949447 AAGTGAGTGGTTTGCTGCCTGGG + Intergenic
1128934398 15:71732970-71732992 TTGTGCTGAGTTTGCTGACTTGG - Intronic
1131900418 15:97082062-97082084 TTGTGATGATTTTGCTGACTCGG + Intergenic
1133495013 16:6309614-6309636 GTGTGTTTAATTTCCTGTCTTGG - Intronic
1149418990 17:56490170-56490192 ATGTGTTTACTTTACTGCCTTGG - Intronic
1151548680 17:74808780-74808802 GTGGGTGGAGTTTGCTGCCTGGG + Intronic
1154187176 18:12195116-12195138 GTGTAAGTATTTTGCTTCCTCGG + Intergenic
1159982423 18:74800724-74800746 TTTTGATTAGTTTGCTTCCTAGG + Intronic
1160418578 18:78728638-78728660 GTTTGATTAATTTGCTGACGTGG - Intergenic
1164040013 19:21485869-21485891 GTGTGACTATTCTACTGCCTTGG + Intronic
1164207263 19:23069309-23069331 ATGTGATTATTCTACTGCCTTGG - Intergenic
1164952745 19:32351819-32351841 GTGAGATTAATTTGTTGACTTGG - Intronic
925145017 2:1575566-1575588 GTTTGCTTAGTGTGCAGCCTTGG + Intergenic
929099024 2:38291302-38291324 GTTTGATTATTTTGATGCCAAGG + Intergenic
929653950 2:43710689-43710711 GGGGGGTTAGTTTGATGCCTTGG + Intronic
937685097 2:124687103-124687125 GTGTGATTAGTTGGGTACCTGGG + Intronic
944041532 2:195361214-195361236 GTATGATGAATTTGCTTCCTTGG + Intergenic
944312585 2:198250570-198250592 GTCTGATCAGTTGGCTGTCTGGG + Intronic
946524990 2:220508697-220508719 GTGTTATTTGTTTGTTGACTTGG - Intergenic
1173362173 20:42354719-42354741 GTGTGCTTCCTTTTCTGCCTGGG - Intronic
1178858174 21:36267473-36267495 GTGTGGCTAGTCTGCAGCCTGGG + Intronic
1180697758 22:17764036-17764058 GAGTGATTTGTTTGCTACTTGGG + Intronic
1182694311 22:32186230-32186252 TTCTGATCAGTTTTCTGCCTTGG + Intergenic
953016771 3:39084668-39084690 AAGTGATTGTTTTGCTGCCTGGG + Exonic
956015908 3:64882314-64882336 TTGTGTTTAGTTTGCTACCTTGG + Intergenic
959620228 3:108391913-108391935 TTCTGACAAGTTTGCTGCCTAGG + Exonic
964755416 3:160087298-160087320 CTGTCATTAGTTAGCTGGCTTGG + Intergenic
964817267 3:160730403-160730425 GTGTGATTTGTTTTCTGAGTGGG + Intergenic
965672724 3:171163125-171163147 CTGTGAGTAGTTAGGTGCCTGGG + Intronic
966262924 3:178001677-178001699 TTGTGCTTAGTGTGGTGCCTGGG + Intergenic
968879468 4:3291927-3291949 GTGTGATTAGTTTGGATCCCAGG - Intergenic
970564325 4:17316623-17316645 ATGTGTTTAGTTTTCAGCCTGGG - Intergenic
971338899 4:25749703-25749725 TTGTGAATTATTTGCTGCCTGGG + Intronic
976377572 4:84362858-84362880 GTTTGTTTAGTCTGCTGCTTGGG - Intergenic
982214489 4:153068896-153068918 GTTTGAATAGTTGGCTGCCTGGG - Intergenic
982289166 4:153762279-153762301 ATTTTATTATTTTGCTGCCTTGG - Intergenic
982587721 4:157263672-157263694 GTGTGTTGAGTTGGCTGCCTTGG + Intronic
983717191 4:170797492-170797514 GTATAATTAGTTGGCTGCCTGGG - Intergenic
983975003 4:173922978-173923000 GAGTGATTTGTTTGCTCACTGGG + Intergenic
985977693 5:3434039-3434061 GAGTGATGAGATTGCTGACTTGG - Intergenic
990236802 5:53777739-53777761 GTCTAATTAATTTGCTTCCTAGG + Intergenic
991153484 5:63400299-63400321 TTGTGATTATGTGGCTGCCTGGG + Intergenic
992257203 5:74932964-74932986 GTGTGGTCAGTTAGCTTCCTTGG + Intergenic
994646404 5:102474545-102474567 CTGTTTTTGGTTTGCTGCCTGGG - Intronic
1002626487 5:180533175-180533197 GTGAGATTAGAGTCCTGCCTTGG + Intronic
1005468479 6:26139121-26139143 GTGTCATTAATTTTCTGCCTAGG + Intergenic
1005862072 6:29909429-29909451 GTGTGACTTGTTTGTTGCCATGG + Intergenic
1007122535 6:39395167-39395189 GTGTGATTATTTTGATTACTTGG - Intronic
1008085556 6:47240428-47240450 CTGTGATTCGTTTGCTGCTAAGG + Intronic
1010329904 6:74610886-74610908 GAGTGATTGATTTGATGCCTGGG + Intergenic
1022908410 7:34877546-34877568 GTGTGTGTAGTCTGCTACCTGGG - Intronic
1024412062 7:49054973-49054995 CTGTAATTAATTTTCTGCCTTGG + Intergenic
1025785775 7:64642260-64642282 GTGTCATTATTCTCCTGCCTTGG + Intergenic
1028187891 7:87810366-87810388 GTGTGATTAGTTTGCTGCCTAGG + Intronic
1030008064 7:105137908-105137930 GTGTGTTTTGTTTTCTGCATGGG - Intronic
1031204441 7:118737763-118737785 GTTTAATTAGTTTGTTGACTAGG - Intergenic
1031486328 7:122330591-122330613 GTGTGAATATTTTCCTGGCTTGG + Intronic
1033597303 7:142866901-142866923 GTGGGATTCGTCTTCTGCCTGGG - Exonic
1037121584 8:15294148-15294170 GTGTGATTTATTTCCTACCTGGG + Intergenic
1038159135 8:25020115-25020137 GTCTGATTAGTTGCCTGCTTGGG + Intergenic
1038505605 8:28082114-28082136 ATGTGTTTAAATTGCTGCCTTGG - Intronic
1039277170 8:35946090-35946112 GTCTGATTAATCTGCTGCCTGGG + Intergenic
1042210119 8:66371695-66371717 CTGTGATCATTTTGCTCCCTGGG + Intergenic
1044234875 8:89819186-89819208 GTCTTATTAGCTTGCTGCTTTGG + Intergenic
1047344078 8:124010248-124010270 AAGTAATTAATTTGCTGCCTCGG - Intronic
1188081702 X:25851017-25851039 GAGTGATTATTTTCCTGCTTTGG + Intergenic
1188800633 X:34525258-34525280 GTGTGATTAATTTGCTGGAGTGG - Intergenic
1193782051 X:85715195-85715217 GTTTGAATAGTTTGCTGTTTGGG + Intergenic
1196996766 X:121391937-121391959 GTGTGATTAATTTTCTTGCTGGG + Intergenic