ID: 1028188584

View in Genome Browser
Species Human (GRCh38)
Location 7:87819262-87819284
Sequence GACTAACCTTTGGTGTACCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 5, 2: 6, 3: 21, 4: 95}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028188584_1028188589 6 Left 1028188584 7:87819262-87819284 CCAGGGTACACCAAAGGTTAGTC 0: 1
1: 5
2: 6
3: 21
4: 95
Right 1028188589 7:87819291-87819313 GGCCATTACATAATGGTAAAGGG 0: 5729
1: 3618
2: 2402
3: 2276
4: 2469
1028188584_1028188588 5 Left 1028188584 7:87819262-87819284 CCAGGGTACACCAAAGGTTAGTC 0: 1
1: 5
2: 6
3: 21
4: 95
Right 1028188588 7:87819290-87819312 AGGCCATTACATAATGGTAAAGG 0: 5714
1: 3583
2: 2208
3: 1732
4: 1867
1028188584_1028188587 -1 Left 1028188584 7:87819262-87819284 CCAGGGTACACCAAAGGTTAGTC 0: 1
1: 5
2: 6
3: 21
4: 95
Right 1028188587 7:87819284-87819306 CTTAGAAGGCCATTACATAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028188584 Original CRISPR GACTAACCTTTGGTGTACCC TGG (reversed) Intronic
900653712 1:3744706-3744728 GGCTCACCTTTGGTGTGTCCAGG - Intergenic
901926854 1:12571478-12571500 CAGGAACCTTTGGGGTACCCGGG + Intronic
906134576 1:43488107-43488129 GCCTAACATGTGGTGTATCCTGG - Intergenic
909715259 1:78700065-78700087 TACTAACCTTTGGTGTAAATGGG - Intergenic
911459370 1:98170166-98170188 GAAAAACCTTTGTTTTACCCAGG - Intergenic
911935844 1:103970757-103970779 GACTAACATATGGTCTATCCTGG + Intergenic
916697180 1:167250641-167250663 GCCAAACCTTTAGTGGACCCTGG + Intronic
924929664 1:248718156-248718178 GCCTAACCTGTGGTCTATCCTGG - Intergenic
1064127731 10:12678398-12678420 GCCTAACATATGGTCTACCCTGG + Intronic
1067096744 10:43306389-43306411 GACTAACCTTTGTTATACTGAGG - Intergenic
1074641361 10:115386627-115386649 GACTAACCTTTGATGTACCTTGG - Intronic
1074874698 10:117604643-117604665 GACTAGCCTTTGGTGCCTCCGGG + Intergenic
1077949136 11:6935783-6935805 GTCTAACATTTGGTCTATCCTGG - Intronic
1082275263 11:50214472-50214494 GACTAACCTTTGATTTACCGCGG + Intergenic
1084136740 11:67189141-67189163 GCCTAACATATGGTGTATCCTGG - Intronic
1087475699 11:98631164-98631186 AACTAACCTTTGATGTACTGTGG - Intergenic
1090133257 11:124168167-124168189 GACTAAACTTTGATGTATCCCGG - Intergenic
1090675526 11:128990949-128990971 GACAAACCTTTTGTGTACCTGGG - Intronic
1091211901 11:133868501-133868523 GCCTAACATATGGTCTACCCTGG + Intergenic
1091717050 12:2785309-2785331 GATTAACCTTTGATGTACGGTGG - Intergenic
1093150594 12:15616708-15616730 GACTAACCTTTGATCTACTGTGG - Intergenic
1093860036 12:24154015-24154037 GACTAACCCTTAGTATGCCCAGG + Intergenic
1094322498 12:29200748-29200770 GACTAACCTTTGATGTACCGTGG + Intronic
1096534549 12:52262947-52262969 GACTAACCTTTGATCTACAGTGG - Intronic
1099526659 12:83725482-83725504 GACTAACCTTTGGTGTACCATGG + Intergenic
1104153512 12:126107983-126108005 GACTAACCTTTGATCTACTGTGG - Intergenic
1105466691 13:20649241-20649263 GCCTAACCTATGGTTTATCCTGG - Intronic
1112158923 13:96848545-96848567 GACTAATCTTTGATGTACCGTGG - Intergenic
1113144471 13:107192519-107192541 GACTAACCTTTGATGTACCACGG - Intronic
1114931027 14:27466933-27466955 GGCTAGCCTCTGGTGGACCCAGG + Intergenic
1116012049 14:39363111-39363133 GCCTAACATATGGTGTAACCTGG + Intronic
1116584354 14:46683823-46683845 GACTAACCTTTGTTCTACCGTGG + Intergenic
1118413474 14:65507128-65507150 GACTAACCTTTGATGTGCCATGG - Intronic
1119247538 14:73125448-73125470 GACTAATCTTGGATGTACCACGG - Intergenic
1120183717 14:81370933-81370955 AAATCACTTTTGGTGTACCCAGG - Intronic
1120982742 14:90305281-90305303 GAGTAACCTGTGGAGTAACCAGG + Intronic
1121106485 14:91283322-91283344 GACTCACCTTTGGTGCGGCCTGG + Exonic
1123204896 14:106702864-106702886 GACTAACCTTTGATCTACCGCGG + Intergenic
1123209898 14:106749305-106749327 GACTAACCTTTGATCTACCGCGG + Intergenic
1128483218 15:68057987-68058009 GATTAACCTTGGGTGTCTCCTGG + Intronic
1131213001 15:90513708-90513730 GACTAACCTTTGATCTACTGTGG - Intergenic
1133543602 16:6782640-6782662 GCCTAACATATGGTCTACCCTGG + Intronic
1137061832 16:35797963-35797985 GACTAACCTTTGATCTACTGTGG + Intergenic
1138065536 16:53937426-53937448 GACTGACCTTTGGGCTACGCAGG - Intronic
1140402284 16:74681425-74681447 GACTAACCTTTGGGGACCCTTGG + Intronic
1142905911 17:3041664-3041686 GACCAACCTTCGGTGTCCCCTGG + Intergenic
1146531862 17:33614319-33614341 GACTACCCATTGGTGTTCTCAGG + Intronic
1157719304 18:49911516-49911538 GACTAACCTTTGATGTACCACGG + Intronic
1161564484 19:4992980-4993002 GACTAACATATGGTTTATCCTGG + Intronic
1161565029 19:4997172-4997194 GAATAACCCTTTCTGTACCCGGG + Intronic
1162086639 19:8253390-8253412 GACCAACTCTTGGGGTACCCAGG - Intronic
1168037151 19:53729043-53729065 GCCTAACCTGTGGTCTATCCTGG + Intergenic
927315781 2:21680219-21680241 GCCTAACATTTGGTCTATCCTGG - Intergenic
927510840 2:23642835-23642857 GACTTACCTCTGGGGTGCCCCGG - Exonic
930138142 2:47923385-47923407 CCCTAACATTTGCTGTACCCAGG + Intergenic
930519495 2:52447222-52447244 GGCTAACTTATGGTGTATCCAGG + Intergenic
931907127 2:66854486-66854508 GACTAACCCTGGGTGTTCCGGGG + Intergenic
934537119 2:95143940-95143962 GACTAACCTTTGATTTACAGTGG + Intronic
934632974 2:95950307-95950329 GACAAACTTTTGGAGTAGCCAGG + Intronic
935158517 2:100507393-100507415 AACTAACGTGTGGTCTACCCTGG - Intergenic
942093121 2:172513254-172513276 GACTAACCTTTGATTTACTGTGG + Intergenic
942093836 2:172519450-172519472 GACTAATCTTTGATTTACCCTGG + Intergenic
946309597 2:218875925-218875947 GACTAACCTCTGGACTTCCCTGG - Intergenic
1177106646 21:16964708-16964730 GCCTAATCTGTGGTTTACCCTGG + Intergenic
1184045577 22:41970549-41970571 GCCTAAACTTTGCTGTAGCCTGG + Intergenic
957943832 3:87037653-87037675 GACTCACCTTTGCCCTACCCTGG - Intergenic
961869743 3:129978672-129978694 TACTTAACTTTGCTGTACCCTGG - Intergenic
964971565 3:162569470-162569492 GACTAACCTTTGATCTACGGAGG - Intergenic
965649662 3:170920177-170920199 GACTAACCTTGAATGTAACCAGG + Intergenic
966167410 3:177035987-177036009 GACTAACCTTTGATGTGCCATGG - Intronic
966346664 3:178988594-178988616 GACTAACCTTTGATCTACTGTGG - Intergenic
972426827 4:38941398-38941420 GAATAACCTTTGGTTTAGCTGGG + Intronic
975423778 4:74202254-74202276 GACTAACCTTTGATCTACCATGG - Intronic
977464217 4:97362881-97362903 GACTAACCTTTGATCTACTGCGG + Intronic
980458094 4:133070963-133070985 CAGTAAACTTTGGTGTTCCCAGG + Intergenic
983441028 4:167785051-167785073 CACAAACCTTTGGAGTAGCCTGG - Intergenic
983984158 4:174037719-174037741 CACTAACCCTTGCTGTGCCCTGG - Intergenic
988005163 5:25401311-25401333 GACTAACCTTTGATCTACCACGG + Intergenic
989495679 5:42109299-42109321 GACTAACCTTTGTTCTACAGTGG + Intergenic
991627012 5:68613267-68613289 GCCTAACATATGGTCTACCCTGG - Intergenic
992990728 5:82280315-82280337 CACTAAACTTTGGTGTGCTCAGG - Intronic
996340124 5:122428525-122428547 GCCTAACATTTGGTCTATCCTGG - Intronic
996847584 5:127917413-127917435 GCCTAACCTTTGGCCTACCTTGG + Intergenic
998646575 5:144068672-144068694 GACTAACATTTGGAGAAGCCAGG - Intergenic
999629760 5:153558856-153558878 GCCTAACCTTTTGTGAGCCCTGG - Intronic
1000417842 5:161002743-161002765 GTCTAACATGTGGTCTACCCTGG + Intergenic
1000458828 5:161486556-161486578 GACTAACCTGTTGTGTGCCCAGG - Intronic
1005442296 6:25882988-25883010 GTATAACCTTCAGTGTACCCTGG - Intergenic
1010875733 6:81103306-81103328 ATTTAACCTTTGGTGTTCCCTGG + Intergenic
1016561730 6:145402717-145402739 GATTAACATTTGGTCTACCTGGG + Intergenic
1018049303 6:159994855-159994877 GCCTAACATATGGTCTACCCTGG + Intronic
1023017747 7:35983829-35983851 GAGTAACCTATGGTGTTCCCAGG - Intergenic
1026506997 7:70993380-70993402 GCCTAGCCTTTGGTGGTCCCAGG + Intergenic
1028188584 7:87819262-87819284 GACTAACCTTTGGTGTACCCTGG - Intronic
1028714013 7:93943097-93943119 GACTAACCTTTGCTGCACACTGG + Intergenic
1031599990 7:123695608-123695630 GACTAAGGTTTTGTGTACCTTGG - Intronic
1033660261 7:143397731-143397753 GTCTGACCCTAGGTGTACCCAGG - Intronic
1038229793 8:25689227-25689249 GGCTAAGCTTTGGTGATCCCTGG - Intergenic
1039454537 8:37698138-37698160 GGCTACCCGCTGGTGTACCCCGG + Exonic
1040959182 8:53012993-53013015 GACTAACCTTTGGCACAGCCAGG + Intergenic
1042513039 8:69631174-69631196 GTCTCACCTTTGGTTTATCCAGG + Intronic
1044235856 8:89829290-89829312 GACAAACCTTTGGCTTCCCCAGG + Intergenic
1045945595 8:107791790-107791812 GCCTAACATATGGTCTACCCTGG - Intergenic
1046677929 8:117132682-117132704 GACAAACCTTTGGTCTACTTTGG - Intronic
1050874340 9:10615339-10615361 AACTATCCTTTGGTGTCCTCTGG + Intergenic
1052004032 9:23324639-23324661 GATTAACCTTTGATGTACCACGG + Intergenic
1052723308 9:32199103-32199125 GCCTAACATTTGGTCTATCCTGG + Intergenic
1053602659 9:39626374-39626396 GACTAACCTTTGATGTACCCTGG + Intergenic
1053860306 9:42380122-42380144 GACTAACCTTTGATGTACCCTGG + Intergenic
1054250879 9:62716061-62716083 GACTAACCTTTGATGTACCCTGG - Intergenic
1054546139 9:66333536-66333558 GACTGACTTTTTGTGTACTCTGG + Intergenic
1054564984 9:66750574-66750596 GACTAACCTTTGATGTACCCTGG - Intergenic
1054876214 9:70098912-70098934 GACTAACATTTGTTGTACTCTGG - Intronic
1062156764 9:135053516-135053538 GACTAGCTTATGGTGTACCCAGG + Intergenic
1062194517 9:135265513-135265535 GACTTACCTTTGGTGTTTCTGGG - Intergenic
1190422148 X:50295889-50295911 GCTTACCCTTTGGTGTTCCCAGG - Intronic
1191210395 X:57878500-57878522 GACCACCCTTTGATGTACCATGG + Intergenic
1195266393 X:103184220-103184242 AACTAACCTTTGATGTACCTTGG - Intergenic
1200886839 Y:8279770-8279792 GGCTAGCCTCTGGTGTGCCCAGG - Intergenic
1200967780 Y:9116478-9116500 AACAAACCTTTGATGTACCATGG - Intergenic
1200968080 Y:9119683-9119705 AACTAACGTTTGATGTACCATGG - Intergenic
1201273741 Y:12280263-12280285 AATTAACCTTTGATGTACCCTGG + Intergenic
1201849791 Y:18466789-18466811 GACTAACCTTTGAGGTACCCTGG + Intergenic
1201883527 Y:18853586-18853608 GACTAACCTTTGAGGTACCCTGG - Intergenic
1202142665 Y:21744392-21744414 AACTAACGTTTGATGTACCATGG + Intergenic
1202144193 Y:21761226-21761248 AACTAACGTTTGATGTACCATGG - Intergenic
1202333932 Y:23785775-23785797 GACTAATCTTTGAGGTACCATGG - Intergenic
1202536836 Y:25884284-25884306 GACTAATCTTTGAGGTACCATGG + Intergenic