ID: 1028192172

View in Genome Browser
Species Human (GRCh38)
Location 7:87866344-87866366
Sequence GAGTTAGATGACATTTTTAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 313}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028192172_1028192174 -6 Left 1028192172 7:87866344-87866366 CCTTTAAAAATGTCATCTAACTC 0: 1
1: 0
2: 1
3: 29
4: 313
Right 1028192174 7:87866361-87866383 TAACTCCTTCCTGGCCTGTATGG 0: 1
1: 1
2: 10
3: 102
4: 577
1028192172_1028192178 28 Left 1028192172 7:87866344-87866366 CCTTTAAAAATGTCATCTAACTC 0: 1
1: 0
2: 1
3: 29
4: 313
Right 1028192178 7:87866395-87866417 AAGTCTGTTGCCAGATGAATTGG 0: 17
1: 47
2: 226
3: 374
4: 665

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028192172 Original CRISPR GAGTTAGATGACATTTTTAA AGG (reversed) Intronic
900724259 1:4204944-4204966 AAGTTAGCTGAAATTCTTAAAGG + Intergenic
902390954 1:16105947-16105969 GATTAGGATGTCATTTTTAATGG - Intergenic
903746620 1:25591272-25591294 GGGTTAGGGGATATTTTTAATGG - Intergenic
908581435 1:65521333-65521355 GAGTCAGATGGCTGTTTTAAGGG - Intronic
909457530 1:75867139-75867161 TAGATAGATGATATTTTAAAAGG - Intronic
910335704 1:86127973-86127995 TAATTTCATGACATTTTTAAAGG + Intronic
910921280 1:92350268-92350290 GAATAAGAGGACATTTTTAAAGG - Intronic
911764292 1:101655691-101655713 GAGGTACTGGACATTTTTAAGGG + Intergenic
912193249 1:107366129-107366151 GAGTTAAGTAATATTTTTAATGG + Intronic
915777404 1:158505670-158505692 TAGTGAGATGATATATTTAAGGG - Intergenic
916334273 1:163652604-163652626 GATTCAAATGACATCTTTAAGGG - Intergenic
916616201 1:166443498-166443520 GAGTGGCATGACATATTTAAAGG - Intergenic
916828630 1:168468038-168468060 GAGTTGGATGACCTTTGCAAAGG - Intergenic
916839257 1:168583338-168583360 AAGTTAGAGGATATTTTCAAGGG - Intergenic
916922201 1:169480702-169480724 GCAGTAGAGGACATTTTTAAAGG - Intronic
917190449 1:172412870-172412892 GAGAAAGATGGGATTTTTAAAGG + Intronic
918379051 1:183936609-183936631 GACTTTAATGACTTTTTTAATGG - Exonic
919233870 1:194812083-194812105 GTTTTACATGACATTTTCAAAGG - Intergenic
921786081 1:219231044-219231066 GAGTTAGCTGTCATTGTTAATGG - Intergenic
923083056 1:230678408-230678430 GAGTTAGCTGCCACTCTTAATGG + Intronic
923120073 1:230981669-230981691 GATCTAAATTACATTTTTAAAGG - Intronic
923357470 1:233173821-233173843 GAGTTGGATCACATTTTCATAGG + Intronic
923424121 1:233851476-233851498 CAATTTGATGACCTTTTTAATGG - Intergenic
1063973727 10:11398847-11398869 GAGATGGATATCATTTTTAAAGG - Intergenic
1064143851 10:12812057-12812079 GTGCCTGATGACATTTTTAAAGG - Intronic
1064548400 10:16474469-16474491 GAATAATATGTCATTTTTAAAGG - Intronic
1065148336 10:22796128-22796150 GATACAGATGACATTATTAAAGG + Intergenic
1065748804 10:28866410-28866432 GAAATAGCTGACATTTTTAATGG - Intronic
1065877646 10:30011173-30011195 GAGTTAGATGAGATTTATTCTGG - Intergenic
1066070868 10:31810243-31810265 AAATCAGATGACATTTTAAATGG - Intronic
1066497781 10:35959083-35959105 GTTTTAGTTGACATATTTAAAGG + Intergenic
1067463174 10:46473419-46473441 GATTTAAATTATATTTTTAAAGG + Intergenic
1067624019 10:47911219-47911241 GATTTAAATTATATTTTTAAAGG - Intergenic
1068233616 10:54203208-54203230 GAGTCACATGACAATTTTAGTGG - Intronic
1068300638 10:55134001-55134023 GATTTATATTAAATTTTTAAAGG - Intronic
1068916645 10:62439866-62439888 AAGTGAGATGATATTTTTGAGGG - Intronic
1069226059 10:65945781-65945803 GATTTAAATAACATATTTAAGGG + Intronic
1071308184 10:84318516-84318538 AAGGTAGATGGCATTTTTATTGG - Intergenic
1071694677 10:87859366-87859388 GAGTTAGATCCCTTTTTGAAAGG + Exonic
1072141185 10:92590643-92590665 GAGGTAGATGACATTTGTTCAGG + Intergenic
1072339897 10:94437080-94437102 AAGTAAGATTACATATTTAAAGG - Intronic
1072828114 10:98629009-98629031 GACTTAGATCACAGTTTTAGAGG - Intronic
1073438454 10:103536661-103536683 GAGTGTGATAGCATTTTTAATGG + Intronic
1074584213 10:114751485-114751507 GTGTTGTATGCCATTTTTAATGG - Intergenic
1075194445 10:120343356-120343378 TAGTTTGATGACATCTTTATTGG + Intergenic
1075857751 10:125644842-125644864 GAGTTCGGTGCCCTTTTTAAGGG - Intronic
1076205517 10:128597560-128597582 GATTTAGATTACCTTATTAAAGG + Intergenic
1076556594 10:131326638-131326660 GTGTGAAATGACATTTTTCAGGG - Intergenic
1078679325 11:13461242-13461264 CAGTCACATGATATTTTTAATGG + Intronic
1079471651 11:20783914-20783936 CAGTTAGATGAAAGTTTTCATGG - Intronic
1079760004 11:24317716-24317738 GAGTGGCATGACATATTTAAAGG - Intergenic
1081353799 11:42088675-42088697 GATTTAGAGGACAGTTTTCAAGG - Intergenic
1085176108 11:74489518-74489540 GAATTAGATGACATAATTATAGG - Intergenic
1085242200 11:75067124-75067146 GAGGTAGATGTCATTCTTTAGGG - Intergenic
1087009849 11:93502822-93502844 TTGTTAGATGTCATTTTTAATGG - Intronic
1087183711 11:95163097-95163119 GAGTTTCATGACGTTATTAAAGG - Intergenic
1087573193 11:99957024-99957046 GAGTTGGCTGACCATTTTAACGG - Intronic
1087770228 11:102201342-102201364 GTGTTTGCTTACATTTTTAAGGG + Intronic
1088419853 11:109634226-109634248 GAGTGGGATGACATATTCAAGGG - Intergenic
1089406813 11:118204336-118204358 GATTTAACTTACATTTTTAAAGG - Intronic
1089800960 11:121026715-121026737 GATTAAGAGGTCATTTTTAAAGG - Intronic
1089887825 11:121845575-121845597 CAGTTAGATAACATTTGTTAGGG + Intergenic
1090438537 11:126707680-126707702 GAGTTAGATGAGAATTTAAATGG - Intronic
1091509591 12:1108293-1108315 AAGTTAGATTATATTTTTAAGGG + Intronic
1092772045 12:11905536-11905558 GAGAGAGAAAACATTTTTAATGG - Intergenic
1093154221 12:15661612-15661634 AAGTTAAGTGGCATTTTTAAAGG - Intronic
1093567531 12:20626057-20626079 AAATTAGATGAGATTTTCAAAGG + Intronic
1094757703 12:33491302-33491324 GAGTGGCATGACATATTTAAAGG + Intergenic
1095124645 12:38462451-38462473 AAGTAAGATGATATTATTAAAGG + Intergenic
1096373459 12:51087511-51087533 GAGTTATTTGAGAGTTTTAAAGG - Intergenic
1096919356 12:55067669-55067691 GAGTAAGACGTTATTTTTAAAGG - Intergenic
1098087958 12:66868316-66868338 GACTTAGATAATATTTCTAAGGG - Intergenic
1098246279 12:68521604-68521626 GCTTTAGAAAACATTTTTAAAGG + Intergenic
1098786328 12:74761332-74761354 GAAATAGATGACATTGTTACTGG + Intergenic
1098842414 12:75492379-75492401 GCCTCATATGACATTTTTAATGG + Exonic
1099048437 12:77753357-77753379 GATTTAGAGGATATTTTAAAGGG - Intergenic
1099325450 12:81209338-81209360 AGGTTATATAACATTTTTAATGG + Intronic
1099649399 12:85405225-85405247 GAGTTATATTAGATTTTCAAAGG - Intergenic
1099843029 12:87990843-87990865 GAGTCAGATAACAGTTTAAAGGG - Intronic
1100334782 12:93618973-93618995 CAGTGAGATGGCATTCTTAAAGG + Intergenic
1100580113 12:95930732-95930754 GAGGTAGAAGACATGATTAATGG - Intronic
1100957728 12:99927616-99927638 GGTTTATATAACATTTTTAATGG - Intronic
1101235136 12:102780954-102780976 GGGGTAAATGACATTTTTACTGG + Intergenic
1101519990 12:105473424-105473446 GAGGTAGATGCCATTATTATAGG + Intergenic
1104254680 12:127125559-127125581 GAGTCTGATTCCATTTTTAATGG - Intergenic
1104820415 12:131673973-131673995 GAGACAGATGAGATTTTTCAGGG + Intergenic
1106142643 13:27024234-27024256 TACTTGGATGACATTTTTATAGG - Intergenic
1107241005 13:38233953-38233975 GAATTAGTTGATTTTTTTAAGGG - Intergenic
1108428540 13:50330027-50330049 TAGTTAGATAAAATATTTAAAGG + Intronic
1108972510 13:56394600-56394622 GAGTCAGATGACATTTTGAGGGG + Intergenic
1108999851 13:56785577-56785599 GAGAAAGATGACATTTTCCAGGG + Intergenic
1109033342 13:57222531-57222553 GATTTAGATGAGATTTATACTGG - Intergenic
1109360543 13:61289774-61289796 AAGTTTGTTCACATTTTTAAGGG - Intergenic
1110084532 13:71361498-71361520 GACTTAAATGTCATTTTAAAAGG - Intergenic
1110105194 13:71665682-71665704 TTGTTAGATGAACTTTTTAAAGG - Intronic
1110658601 13:78031061-78031083 GATTTATATAACTTTTTTAAAGG - Intergenic
1110828462 13:80001108-80001130 GATTTAGATGTCATATTTCAGGG - Intergenic
1110955035 13:81543747-81543769 AATTTTGATCACATTTTTAAAGG + Intergenic
1111676200 13:91391945-91391967 GAGCTAAAAGTCATTTTTAAAGG - Intergenic
1112943892 13:104900859-104900881 GAGATGGACGAGATTTTTAATGG - Intergenic
1113027990 13:105962187-105962209 GAGTATGATGACATTTTCACAGG + Intergenic
1113058731 13:106298373-106298395 AAGTAATATGATATTTTTAAGGG - Intergenic
1113118619 13:106901761-106901783 TAGTTACTTCACATTTTTAATGG + Intergenic
1113384943 13:109839938-109839960 GTGTAATATGACATTTTGAAGGG + Intergenic
1113718872 13:112536541-112536563 TATTTAGATGATATTTTAAATGG + Intronic
1115165356 14:30442230-30442252 AAGTAAGATGAGATTTATAATGG + Intergenic
1115946708 14:38669733-38669755 GAGAAGGATGACATTTTGAAAGG + Intergenic
1117345152 14:54824400-54824422 GAGTGAGATGATATATTCAAGGG + Intergenic
1118413291 14:65505061-65505083 AAGTTATATGACATTTTTTTGGG + Intronic
1118682402 14:68256396-68256418 AAATTAGATGACACCTTTAATGG - Intronic
1119077673 14:71659679-71659701 GAGAAAGATGAGATTTGTAAGGG + Intronic
1120426517 14:84354371-84354393 GAGTGGCATGACATATTTAAAGG + Intergenic
1120688007 14:87561349-87561371 AATTTAGATGATGTTTTTAATGG - Intergenic
1121376168 14:93412726-93412748 GAGTGGCATGACATATTTAAAGG + Intronic
1121879886 14:97490482-97490504 GAGTCAGAAGACATATTTAATGG - Intergenic
1125753403 15:42045752-42045774 GAGCTGGATGACATCTCTAAAGG - Intronic
1127637386 15:60884373-60884395 GGGGCAGATGACATTTTTCAGGG - Intronic
1127835266 15:62785715-62785737 GTGGTAGATTCCATTTTTAAAGG - Intronic
1127934612 15:63624909-63624931 GAAATAGATGAAATTATTAATGG - Intronic
1129148359 15:73670450-73670472 AAGATAGCTGACACTTTTAAGGG - Intergenic
1131409569 15:92195573-92195595 CAGATTGATGACATTTTTAGAGG - Intergenic
1135764986 16:25169865-25169887 AAAATAGATGACTTTTTTAAAGG - Intronic
1136985868 16:35103770-35103792 GAATTCGATGACATTTCTAAGGG - Intergenic
1137242835 16:46672756-46672778 GAATTTGATGACATTTCTAAGGG + Intronic
1138035456 16:53601081-53601103 GATTTAATTGATATTTTTAATGG - Exonic
1138343577 16:56306696-56306718 AATTAAGATGACATTTTAAAAGG + Intronic
1138997734 16:62475003-62475025 GAATTACATGACATTTTGGAGGG + Intergenic
1141111582 16:81275018-81275040 CAGTAAGAAGACATATTTAAGGG - Intronic
1143174120 17:4947073-4947095 GATTTAGATGTCAGTGTTAATGG + Intronic
1143839110 17:9717465-9717487 GAACAAAATGACATTTTTAAAGG - Intronic
1144599894 17:16602274-16602296 GAATGAGATGTTATTTTTAATGG - Intergenic
1145105601 17:20112980-20113002 GTGTTAGATGAGAATTTTAGGGG + Intronic
1148618307 17:49015916-49015938 GAGCAAGATGACATTTTGCATGG + Intronic
1149766736 17:59285109-59285131 GAGTTAGATGATACCTTCAAAGG + Intergenic
1150582561 17:66488308-66488330 GAAGAAAATGACATTTTTAAAGG + Intronic
1153502017 18:5759477-5759499 CAGATAGATAATATTTTTAATGG + Intergenic
1155612430 18:27682002-27682024 GAGCAAGATGACATCCTTAATGG + Intergenic
1155646458 18:28084264-28084286 GAGTTCAGTGACATTTTTAGAGG - Intronic
1155813669 18:30274284-30274306 GAGTGAGATGCTATTTTTAAGGG - Intergenic
1156359830 18:36375160-36375182 GTGTTAGATGAGATTTCTTATGG + Intronic
1156941152 18:42768258-42768280 GATTTAGATGATTTTGTTAATGG - Intronic
1157287674 18:46388167-46388189 TAGTAAGATGGCATTTTCAAGGG + Intronic
1158412074 18:57215352-57215374 CAATTAGATGATATTTGTAATGG + Intergenic
1159287486 18:66373117-66373139 GAGGCACATGACATTTTAAAAGG + Intergenic
1159329925 18:66979358-66979380 GAGTTAATTTACATATTTAAAGG + Intergenic
1159460412 18:68715824-68715846 GAACTAGATGAAATTTTTATGGG + Intronic
1162251034 19:9443819-9443841 AAATTAAATGACATTTTTTAAGG - Intergenic
925617661 2:5758962-5758984 GAGTGAGACTACACTTTTAAAGG + Intergenic
928519655 2:32076223-32076245 AAATAAGGTGACATTTTTAAGGG + Intronic
929745106 2:44649102-44649124 AAGTGAGATGACATTTTAACTGG + Intronic
929912880 2:46106755-46106777 GAATTAAATGACCTCTTTAAAGG + Intronic
929963542 2:46514967-46514989 GAGTAAGATGATATATTCAAAGG + Intronic
931114932 2:59155094-59155116 CACTTACATTACATTTTTAATGG + Intergenic
931835340 2:66093132-66093154 CAGTTATGTGACATCTTTAAAGG + Intergenic
932510280 2:72279924-72279946 AATTTAGATAACTTTTTTAAAGG + Intronic
932719395 2:74127235-74127257 GAGTTAGCTTACATTTTACAAGG + Intergenic
932799595 2:74729068-74729090 GAGTGAGATGACATTTTCGAAGG - Intergenic
933047401 2:77556738-77556760 CAGGCAGATGGCATTTTTAAAGG + Intronic
933743747 2:85554906-85554928 GAGTGAGAGGACACTTTAAAAGG + Intronic
935040099 2:99417942-99417964 GTGTAATATGACATTTTTGATGG - Intronic
935155033 2:100477199-100477221 AAGTTAGATGAAATTTTACAGGG - Intronic
936465266 2:112742870-112742892 TAGTTAGACGAGATTTTAAAAGG - Exonic
940144447 2:150531500-150531522 AAGCTATATGAGATTTTTAAAGG - Intronic
940450137 2:153826649-153826671 GATCTAAATGATATTTTTAATGG + Intergenic
941218729 2:162747784-162747806 TACTTATATAACATTTTTAAAGG + Intronic
941866232 2:170337435-170337457 GAGTCAAATCACATTTTTAGAGG - Intronic
942358260 2:175143378-175143400 TAAATAGATGTCATTTTTAACGG + Intronic
942796092 2:179821337-179821359 GTCTGAGAGGACATTTTTAATGG - Intronic
943272075 2:185818650-185818672 CAGTGAGATGATATATTTAAAGG + Intronic
943381065 2:187148944-187148966 AAGTTGGATAACATTTTTAATGG - Intergenic
943492890 2:188579082-188579104 GACTTAGATTTCATTTTTATAGG + Intronic
943513740 2:188858757-188858779 GAGGTAGATGACATTTGAAGAGG + Intergenic
943845288 2:192637050-192637072 GAGTGGCATGACATATTTAAAGG + Intergenic
946605006 2:221393901-221393923 TAGTAAGAAAACATTTTTAAAGG - Intergenic
946959532 2:224969267-224969289 ACGTTAGATGACTTTCTTAAGGG - Intronic
1170380681 20:15756470-15756492 GAGTAAAATAACATTGTTAAAGG + Intronic
1170708995 20:18773261-18773283 GAGTGGCATGACATATTTAAAGG - Intergenic
1172153620 20:32808381-32808403 TAGCTACAGGACATTTTTAAGGG + Exonic
1172825844 20:37785068-37785090 GAGTGGCATGACATATTTAAAGG - Intronic
1177599621 21:23293533-23293555 GAATTAAATAACATTTATAAAGG - Intergenic
1178572838 21:33756580-33756602 GAGTTGGACGAGATTTTGAAGGG + Intronic
1179391941 21:41002074-41002096 GATTTACATGAAATTTTAAAAGG - Intergenic
1182863118 22:33578355-33578377 GAATTAGGTGATTTTTTTAAAGG - Intronic
1182881377 22:33736826-33736848 GAGTTAAAACACATTTTTTATGG - Intronic
1183807728 22:40225898-40225920 GACTTGGATGTCATTTTAAATGG + Intronic
1184624446 22:45712789-45712811 GAGTTAAATAACATTTCCAACGG - Intronic
1185240921 22:49746188-49746210 CAGTAGGATGACATATTTAAAGG - Intergenic
950011558 3:9727755-9727777 GAGTGAGATGGCATTTTAAAAGG + Intronic
950695357 3:14696977-14696999 GAGTGGCATGACATATTTAAAGG - Intronic
951496356 3:23331838-23331860 GATTTAGCTTACATTTCTAAAGG + Intronic
951606366 3:24439197-24439219 GAGGTAGATGTCATTGTCAAGGG + Intronic
951738561 3:25895360-25895382 GATTTAATTTACATTTTTAAAGG - Intergenic
951874788 3:27410897-27410919 GATTTTGATGACATCCTTAAAGG - Intronic
952294037 3:32045598-32045620 GAATTAACAGACATTTTTAAAGG + Intronic
952507177 3:34017910-34017932 TAATTAAATGACATTTTTACAGG + Intergenic
954884447 3:53859566-53859588 CATATAGATGACATTTTTACAGG - Intronic
955129184 3:56146893-56146915 GAGTTAGATTTAACTTTTAATGG - Intronic
955392049 3:58529099-58529121 ATGTTAGATGGGATTTTTAAAGG - Intronic
957782672 3:84839747-84839769 TAGTTAGCTAACACTTTTAATGG - Intergenic
958528794 3:95296814-95296836 AAATTACATGACATTTCTAAAGG - Intergenic
959180033 3:102967530-102967552 GAGTCAGTAGATATTTTTAAAGG - Intergenic
959481719 3:106881105-106881127 AAGTTGGATGCCATTTTTTATGG - Intergenic
959547232 3:107611537-107611559 GAGTGGCATGACATATTTAAAGG - Intronic
962169640 3:133087528-133087550 CAGTTTCATGACATTTTTTAAGG - Intronic
962248350 3:133817918-133817940 GAGTAAATCGACATTTTTAAAGG + Intronic
962916750 3:139911419-139911441 GGGTGAGATGACCTTGTTAATGG - Intergenic
962992738 3:140593737-140593759 GAAAAAGATGGCATTTTTAATGG - Intergenic
963596220 3:147328609-147328631 AAGATAGATTACATTTATAACGG - Intergenic
963638635 3:147831363-147831385 GAGTAGCGTGACATTTTTAACGG + Intergenic
963966990 3:151383081-151383103 GAGTTAAAAGACTTTTTAAATGG - Intronic
964948214 3:162252510-162252532 GTGTTAAATAATATTTTTAAAGG + Intergenic
965348520 3:167583175-167583197 AAGTTAAACGACATTTTTAAAGG - Intronic
965936191 3:174115797-174115819 GAGTTAAATGACATTTTTTGAGG - Intronic
966041366 3:175492887-175492909 GAGCTAGAAGATGTTTTTAATGG - Intronic
966209454 3:177437946-177437968 CAGTTAGATAATTTTTTTAATGG - Intergenic
967241530 3:187444495-187444517 GAGTTAGATAACTTTTTAATTGG - Intergenic
970479060 4:16454560-16454582 GAGTTGGAAGATATTTATAAGGG + Intergenic
970498892 4:16656211-16656233 GAACAAGATTACATTTTTAAAGG - Intronic
971441034 4:26685980-26686002 GAATTGGATGAAAGTTTTAATGG + Intronic
972526706 4:39920146-39920168 AAGTTTCATGACGTTTTTAAAGG - Intronic
972616938 4:40707983-40708005 GAAATAGATGATATTTTTATAGG - Intergenic
974122523 4:57656966-57656988 TAGTTCCATGACATTTTTAAAGG + Intergenic
975062795 4:70023600-70023622 GGCATAGATGACATTTTAAATGG + Intergenic
975725612 4:77288917-77288939 ATGTTATATGTCATTTTTAATGG - Intronic
976675306 4:87695875-87695897 GAATTAGATAGCATTTATAATGG - Intergenic
977094051 4:92715796-92715818 GAGTAAGATGAGATTTGTATGGG + Intronic
978020247 4:103800540-103800562 GAGCTTTATGACATTTTTCAAGG + Intergenic
978180795 4:105793133-105793155 GATTTAGATAACACTTATAAAGG - Intronic
979045207 4:115853814-115853836 GACTTAGAAGAGATTTTGAAAGG + Intergenic
979904497 4:126269557-126269579 GAGTTAATTGACATGTCTAAGGG + Intergenic
980888343 4:138787080-138787102 GAGGCAGATGACACTTGTAAGGG + Intergenic
981489018 4:145320259-145320281 GACTTTGATGATTTTTTTAAAGG - Intergenic
982486032 4:155966944-155966966 GAGAGAGATGACATTCTTCAGGG + Intergenic
982827261 4:160017090-160017112 GAGTTACAGGACATTTACAAAGG + Intergenic
982866571 4:160520535-160520557 GACTTTGGTGACATTTTTAGGGG + Intergenic
983034527 4:162847002-162847024 GAGCAAGATGACTTTTTAAAAGG - Intergenic
983767595 4:171505008-171505030 GGGTGAGATGATATTTTTCATGG - Intergenic
984490385 4:180427167-180427189 GCATTAGATAACATTATTAATGG + Intergenic
986157426 5:5190652-5190674 GAGTTAGAAGACATGTTCAGCGG - Intronic
986913069 5:12581472-12581494 TTTTTAGATGACATTTTTATAGG + Intergenic
987282990 5:16429303-16429325 TATTTAGTTGATATTTTTAAAGG + Intergenic
988176118 5:27727972-27727994 AAGTTAGATGAGAATCTTAATGG - Intergenic
988623602 5:32848056-32848078 GAGATAGATTATATTTTAAATGG - Intergenic
988799422 5:34682481-34682503 GAGTTAAATTATTTTTTTAAAGG + Intronic
989233280 5:39113065-39113087 GTTTTAGCTGAGATTTTTAAAGG - Intronic
989393426 5:40926043-40926065 GTGGTAGATGATACTTTTAATGG - Intronic
989472228 5:41833342-41833364 GAGTAGCATGACATATTTAAAGG + Intronic
989518929 5:42378086-42378108 GAATTGGATGTCATATTTAAAGG + Intergenic
989814481 5:45719779-45719801 GAGTTAGAGGTTTTTTTTAATGG + Intergenic
989836166 5:45995161-45995183 GATTTAAACAACATTTTTAATGG + Intergenic
990163425 5:52968719-52968741 GGATTAGTTGATATTTTTAAGGG + Intergenic
993039751 5:82800548-82800570 AAGTTTGATGAGATTGTTAAAGG - Intergenic
993249612 5:85502347-85502369 AAGGTAGAATACATTTTTAATGG + Intergenic
993512289 5:88786082-88786104 CAGTTAGAAGACATTTGTTAGGG + Intronic
995251526 5:109998682-109998704 GAGTCAAATGACATTTGTAAAGG + Intergenic
995300814 5:110579184-110579206 GAGTGAGATGATATGTTCAAAGG + Intronic
995322676 5:110854913-110854935 GAGTAAGATGAAATTTTGGAAGG - Intergenic
996282572 5:121748732-121748754 GAGGCAGATGATATTTTTATGGG - Intergenic
996968849 5:129338875-129338897 GAGTAAGATGCAATTTTAAATGG - Intergenic
997351417 5:133233943-133233965 GGGTTAGCTGACTTTCTTAAGGG + Intronic
998721810 5:144960577-144960599 AAGTGAGATGCCATTTTAAAAGG - Intergenic
999981899 5:156965853-156965875 GAGTTAGATGTCATGTTTTCTGG - Intergenic
1000298374 5:159932720-159932742 TATTTATATGATATTTTTAATGG + Intronic
1000449717 5:161370817-161370839 AATTAAGAGGACATTTTTAATGG - Intronic
1000811348 5:165865657-165865679 TATTTAGATGATTTTTTTAAGGG - Intergenic
1003699487 6:8446220-8446242 GAGTTTGGTGATATTTTTACAGG - Intergenic
1003700764 6:8462496-8462518 GAGAGAGATGACATCTTTACAGG + Intergenic
1003955440 6:11161164-11161186 GAGTGGGATGAGGTTTTTAAAGG - Intergenic
1004069279 6:12283165-12283187 AAGTTAGATGACTTTTTAAACGG - Intergenic
1005267767 6:24130689-24130711 TAGTTATATGCCCTTTTTAAAGG + Intronic
1005328765 6:24728589-24728611 GAGTTAGATGAGATTCACAAAGG + Intergenic
1006119945 6:31797912-31797934 TGGTTAGAGGACATTTTTAAGGG - Intronic
1006905883 6:37533216-37533238 AAGTGAGTTAACATTTTTAAAGG - Intergenic
1008678570 6:53847271-53847293 AATTTGGATGAGATTTTTAAAGG - Intronic
1009866275 6:69401550-69401572 TGGTGAGATAACATTTTTAAAGG - Intergenic
1010014502 6:71088760-71088782 GAGATAGATGACATTAGTACTGG - Intergenic
1011816319 6:91195181-91195203 TAATTAGATGACCTCTTTAAAGG + Intergenic
1012339519 6:98102523-98102545 GAGTTTGGTGACTTTTTGAATGG + Intergenic
1014197851 6:118579429-118579451 GAGTTGAATGAAATTTTAAAAGG - Intronic
1014831294 6:126105724-126105746 GAGTTAGCTTTCATTTTTTAGGG + Intergenic
1016707958 6:147135506-147135528 GAGTTAGATTTCAGGTTTAAAGG - Intergenic
1020340647 7:7105935-7105957 GATTTAAAAAACATTTTTAAAGG + Intergenic
1020507786 7:9016477-9016499 CAGTCAAATGACATATTTAAAGG - Intergenic
1021191621 7:17626975-17626997 GATTTAGATTACTTTGTTAATGG - Intergenic
1022885185 7:34636059-34636081 GGGTTCGTTGATATTTTTAAGGG - Intergenic
1023067785 7:36396029-36396051 TAGTTATATAAGATTTTTAACGG - Intronic
1024863550 7:53875897-53875919 AAGTTAGATATCATTTTAAACGG - Intergenic
1026615928 7:71904406-71904428 GAACTAGAGGACATTGTTAAGGG + Intronic
1027890496 7:83967325-83967347 GAGATAGAACACATTGTTAATGG - Intronic
1028192172 7:87866344-87866366 GAGTTAGATGACATTTTTAAAGG - Intronic
1029042466 7:97592117-97592139 GAGTTGCATGACATATTTAAAGG - Intergenic
1030069235 7:105684583-105684605 CAACAAGATGACATTTTTAAAGG - Intronic
1032571748 7:133007756-133007778 GAATTAGAGGACATTTTCAAAGG - Intronic
1034107933 7:148506926-148506948 GAGGCAGATGAAATTTTTGATGG + Intergenic
1035274072 7:157736934-157736956 GATGGGGATGACATTTTTAAAGG + Intronic
1037825432 8:22157834-22157856 GACATAAATCACATTTTTAATGG - Intronic
1038964504 8:32556807-32556829 GACTTACATTGCATTTTTAAAGG + Intronic
1039761125 8:40576501-40576523 GAATGGGATGACATATTTAAGGG + Intronic
1040345240 8:46485987-46486009 GAGTATGCTGACATTTTTACAGG - Intergenic
1040563794 8:48547971-48547993 GAGTTAGCTCACTTTTTTGAGGG + Intergenic
1041502768 8:58556506-58556528 CAGTCACATGTCATTTTTAAGGG + Intronic
1041595957 8:59653355-59653377 CAGTTAGAAGACATCTTTGAAGG - Intergenic
1041726326 8:61021079-61021101 GAGTGAAATGATTTTTTTAAAGG - Intergenic
1043980622 8:86634572-86634594 TATATAAATGACATTTTTAAAGG - Intronic
1044431091 8:92108366-92108388 GAGTAAATTGATATTTTTAAAGG - Intergenic
1044492535 8:92836256-92836278 GTGTTAGAAGCCATTTCTAAAGG - Intergenic
1046451993 8:114405606-114405628 GAGTTACAGGATTTTTTTAATGG - Intergenic
1046547636 8:115671124-115671146 GATTTAGATGACATTTTAAAAGG + Intronic
1046624889 8:116565916-116565938 GTGTTAGATGAGATTTTGAAAGG - Intergenic
1049870840 8:144974590-144974612 GATTTGGATGAAATATTTAATGG + Intergenic
1050565136 9:6874561-6874583 GAATTAGATGACTTTTTTTGTGG + Intronic
1050618861 9:7431938-7431960 GCCTTACATGACATATTTAAGGG - Intergenic
1050755966 9:9003583-9003605 GAGTTAGATGACTGTTTAACTGG - Intronic
1050756787 9:9014388-9014410 CTATTAGGTGACATTTTTAAGGG - Intronic
1051622552 9:19066552-19066574 GAGTTCCATGATATTTCTAACGG - Intronic
1052733088 9:32312302-32312324 GAGTGTCATGACATATTTAAAGG + Intergenic
1058225000 9:102349468-102349490 CATTTTGCTGACATTTTTAAAGG - Intergenic
1058981388 9:110173787-110173809 GACTTTGATCAAATTTTTAAAGG - Intergenic
1059025551 9:110624932-110624954 GAGTAATATTACATTTTTGATGG - Intergenic
1059287273 9:113185386-113185408 GAGGGAGATGACAGTTTTGATGG + Intronic
1059555896 9:115279984-115280006 GAGATAGAAAACAATTTTAATGG - Intronic
1059914897 9:119088045-119088067 CATTTGCATGACATTTTTAAGGG + Intergenic
1059943792 9:119385250-119385272 CAGTGAGATGACATTTCAAATGG - Intergenic
1060439251 9:123623426-123623448 GAGTTAAAACAGATTTTTAATGG + Intronic
1186143105 X:6597908-6597930 GTATTAGATGACATTCTTCAAGG + Intergenic
1188342494 X:29021267-29021289 GAGAAAGATGACATTTTGAAGGG - Intronic
1188870857 X:35369367-35369389 CATTTATATGACATTTTTAAAGG - Intergenic
1189641260 X:43073842-43073864 GACTTTGCTGACATTTTTATAGG + Intergenic
1192091588 X:68164029-68164051 GGATTAGATGACATTTTATATGG - Intronic
1192490697 X:71574479-71574501 GAGTTACAGGAGAATTTTAAGGG - Exonic
1192838987 X:74834606-74834628 GAGTGGCATGACATATTTAAAGG - Intronic
1192977786 X:76304196-76304218 GAGTGACATGACATATTTAAAGG - Intergenic
1193240375 X:79162092-79162114 TAGTTGGATGATTTTTTTAAAGG + Intergenic
1193756589 X:85417051-85417073 GAGTGACATGACATATTTAAAGG - Intergenic
1193983844 X:88216448-88216470 GAGTTAGCTGGCATTTTAACTGG + Intergenic
1193999277 X:88407848-88407870 GAATAAAATAACATTTTTAAAGG - Intergenic
1194417691 X:93633505-93633527 GAGATAAAGGACATTTTTAATGG + Intergenic
1195759813 X:108234322-108234344 GAGTTACATGACATTTTATCTGG - Intronic
1195828684 X:109032008-109032030 GAGTGACATGACATATTTAAAGG - Intergenic
1196375226 X:115025954-115025976 GATGTAGATTACATTTTAAAGGG + Intergenic
1197443961 X:126525559-126525581 GAGCTAGATGACAATATTGAGGG + Intergenic
1197715365 X:129702405-129702427 GAGTTAGATAACTAGTTTAAAGG - Intergenic
1198324410 X:135553929-135553951 GAGGCATATGACATATTTAAGGG - Intronic
1198430242 X:136558253-136558275 GTCTTAGCTGAGATTTTTAAAGG - Intergenic