ID: 1028193970

View in Genome Browser
Species Human (GRCh38)
Location 7:87883586-87883608
Sequence TACCTACATTTATTTATTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 337
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 297}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028193970_1028193972 14 Left 1028193970 7:87883586-87883608 CCTGGAATAAATAAATGTAGGTA 0: 1
1: 0
2: 1
3: 38
4: 297
Right 1028193972 7:87883623-87883645 CAATGAAAATGAATGTTGGTCGG No data
1028193970_1028193971 10 Left 1028193970 7:87883586-87883608 CCTGGAATAAATAAATGTAGGTA 0: 1
1: 0
2: 1
3: 38
4: 297
Right 1028193971 7:87883619-87883641 TGTTCAATGAAAATGAATGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028193970 Original CRISPR TACCTACATTTATTTATTCC AGG (reversed) Intronic
900662715 1:3793397-3793419 AAACTACCTTTAATTATTCCTGG + Intronic
906987701 1:50703529-50703551 CAACTGCATTTATTTGTTCCTGG + Intronic
907367497 1:53974620-53974642 TTCCTTAATTTTTTTATTCCTGG + Intergenic
907668757 1:56456056-56456078 TAGCTTTATTTATTTTTTCCTGG - Intergenic
908151765 1:61309888-61309910 CACCTAAATTTATTTATTTCTGG - Intronic
908422254 1:63970336-63970358 TACCTACAATTACATATTACTGG - Intronic
908442421 1:64168873-64168895 AAACTACATCCATTTATTCCAGG + Intronic
908704372 1:66935066-66935088 TTACTAGATTTTTTTATTCCAGG - Intronic
909266615 1:73567417-73567439 TAACTACATTTGTTTATTGCTGG - Intergenic
911332043 1:96536234-96536256 TATCTAAATTCATTTAATCCAGG + Intergenic
911539223 1:99138382-99138404 TAGCTAGATCTTTTTATTCCAGG + Intergenic
911899209 1:103480048-103480070 GGCCTACATTTATTTTTACCTGG - Intergenic
912881330 1:113418977-113418999 TGCCAACATTAATTTCTTCCAGG - Intronic
913102002 1:115576700-115576722 TACCTACATGTAATTTTTGCTGG - Intergenic
913396743 1:118379861-118379883 TTCCTACATTTCAATATTCCAGG + Intergenic
913523201 1:119665834-119665856 TAGATACATTTCTTTATTCCTGG - Intronic
914694978 1:150069021-150069043 GACCCACATTACTTTATTCCTGG + Intronic
916309478 1:163379425-163379447 TTCTTACATTTATTTATTTCTGG + Intergenic
916537508 1:165717558-165717580 TTATTACATTTTTTTATTCCTGG - Intergenic
916722331 1:167493867-167493889 TATCTAGAATTATTAATTCCAGG + Intronic
918288846 1:183086064-183086086 TACATATATTTATTTATTTATGG - Intronic
918454336 1:184692418-184692440 TACCTGCATTCAGATATTCCAGG - Exonic
919431185 1:197493888-197493910 TACCAACATTTTTTTCTCCCAGG - Intergenic
919665651 1:200288905-200288927 TAACTAGATTTTTTTTTTCCTGG - Intergenic
920778383 1:208963710-208963732 TAAATACATTGATTTATTTCTGG + Intergenic
921549163 1:216512120-216512142 TACCTAAATTTATTAATCACTGG - Intronic
923956671 1:239030395-239030417 TAGCTACATTTTTTTCTTCCAGG - Intergenic
924596659 1:245451398-245451420 TTATTACATTTATTTATTTCTGG + Intronic
924838748 1:247684779-247684801 TAAATACATGTATTTATTGCTGG + Intergenic
1063326122 10:5103985-5104007 TACATACATATATATATTCTGGG + Intronic
1063431783 10:5997035-5997057 AATTTACATTTATTTAATCCTGG - Intergenic
1066327162 10:34373297-34373319 TACCTACTTTTTTTTTTTCTTGG - Intronic
1070893637 10:79963010-79963032 TACCTACCTTTCCTTATTCCTGG + Intronic
1076652579 10:131999971-131999993 TAGCTACATTTTTTTCTTCCAGG + Intergenic
1078378783 11:10820487-10820509 CACTTACATTTCTCTATTCCAGG - Intronic
1078956438 11:16201380-16201402 CAGCTACATAAATTTATTCCAGG - Intronic
1079070896 11:17345792-17345814 TACTTAGATTTATTTTTTCTTGG + Intronic
1080005352 11:27400430-27400452 TATTTACATTGTTTTATTCCTGG - Intronic
1081158396 11:39723364-39723386 TTCATTCATTTATTTATTTCTGG - Intergenic
1081191402 11:40106464-40106486 TACATTCATTCATTTATTCGTGG - Intergenic
1085821324 11:79796753-79796775 TTCACACATCTATTTATTCCAGG + Intergenic
1086161707 11:83728899-83728921 TACCAACCTTAATTTATTCCTGG - Intronic
1086172762 11:83855193-83855215 TACCTGCACTTATTCATTGCTGG + Intronic
1086199704 11:84186845-84186867 TACCTAAGCTTATTTATTTCTGG - Intronic
1086203391 11:84230433-84230455 TACAAACATTTATTTATTACTGG - Intronic
1087071656 11:94087682-94087704 CCCCTACATTTGTTTTTTCCAGG - Intronic
1088162988 11:106896092-106896114 TACTTACATTTATACATTCTTGG - Intronic
1088921961 11:114266104-114266126 TACTTACATTCATTTCTTCTCGG + Intronic
1089259090 11:117210683-117210705 TTCTTCCATTAATTTATTCCAGG + Intronic
1090190850 11:124766865-124766887 TACCTACATTTGTTTATATTAGG + Exonic
1091080490 11:132662603-132662625 TACCTTCTTTTATTTTATCCAGG - Intronic
1093073950 12:14737521-14737543 TAGCTTCATTTGTTTATTCGTGG + Intergenic
1093291581 12:17331289-17331311 TACAAACATTTATTGATTCGGGG + Intergenic
1094034060 12:26048043-26048065 TACCTCCAAGTTTTTATTCCTGG + Intronic
1094641594 12:32281252-32281274 TTGCTACATTTACTTTTTCCTGG + Intronic
1096037300 12:48483615-48483637 TAGGGACATTAATTTATTCCAGG + Intronic
1096455220 12:51779334-51779356 TAACTACATTTATGCCTTCCTGG - Intronic
1096852770 12:54452759-54452781 CACCTACATTTGTTTTTTCCTGG + Intergenic
1097005111 12:55911066-55911088 TAGCTAGATCTATTTCTTCCAGG - Intronic
1097494908 12:60319044-60319066 TATCTTTCTTTATTTATTCCAGG - Intergenic
1098464856 12:70775232-70775254 TACCTATATTTAAATATACCAGG + Intronic
1099220019 12:79902722-79902744 AACCTACATTTTTATATTACAGG + Intronic
1099459062 12:82900795-82900817 TTCCTATATATATATATTCCAGG - Intronic
1099459065 12:82900826-82900848 TTCCTATATATATATATTCCAGG - Intronic
1099459068 12:82900857-82900879 TTCCTATATATATATATTCCAGG - Intronic
1099777711 12:87154448-87154470 TACTTTCATTTCTTTATTCTTGG + Intergenic
1101515738 12:105433703-105433725 TAACTGCATTGATTTATTCATGG + Intergenic
1102331120 12:112031826-112031848 TTCCTACATTTCTTTCTACCTGG + Intronic
1102739189 12:115191613-115191635 TACCTTCACTCATTTAATCCTGG - Intergenic
1103375650 12:120453686-120453708 TACCTAGCTTTATTAATTACAGG - Intronic
1105618022 13:22038786-22038808 TGGCTAAATTTAGTTATTCCAGG - Intergenic
1105818465 13:24058145-24058167 TACATAAATTTAGTTATTGCTGG + Intronic
1106672238 13:31918381-31918403 TAAGTACACTTATTTATCCCAGG + Intergenic
1109525786 13:63573672-63573694 TACCTAAATTTATCTATTTTAGG + Intergenic
1109592884 13:64510116-64510138 TTTCAACATTTATTTATTCAAGG + Intergenic
1109621688 13:64916561-64916583 TACCTTCATTTTTTTTTTTCTGG + Intergenic
1110932308 13:81236606-81236628 TAGTTACATTTATTTAATCCAGG + Intergenic
1111046318 13:82818241-82818263 TAAATACATTTATTTGTTTCTGG - Intergenic
1111287207 13:86110187-86110209 TACCTACATTTTTTTTTTCTCGG + Intergenic
1112522954 13:100114379-100114401 AACATCCATTTATTTATTCTAGG - Intronic
1113355259 13:109573179-109573201 TAAATACATGTATTTATTTCTGG - Intergenic
1116219233 14:42060940-42060962 TATTTACATATATTTTTTCCAGG + Intergenic
1117758067 14:58997174-58997196 TTCCTTCATTCATTTAATCCAGG - Intergenic
1118473985 14:66100286-66100308 AAGCTACCTTTAATTATTCCTGG + Intergenic
1119639107 14:76301079-76301101 TACATACATGCATTTATTTCTGG - Intergenic
1120599228 14:86480460-86480482 TGCCTACATTTATTTTTTAAAGG - Intergenic
1123886727 15:24734077-24734099 TACCTACATCTGTTTAGTCATGG - Intergenic
1126609831 15:50518170-50518192 TAAATACATGTATTTATTTCTGG - Intronic
1126722660 15:51598306-51598328 TACATACATATATTTTTTTCTGG + Intronic
1127121577 15:55776528-55776550 TACCTTGGTTTATTTAGTCCTGG + Intergenic
1127202754 15:56674392-56674414 TACAGATATTTATTTATTCTTGG - Intronic
1127202827 15:56675483-56675505 TACAGATATTTATTTATTCTTGG - Intronic
1127516801 15:59702703-59702725 TAAACACATTTATTTATACCAGG + Intergenic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1127889410 15:63235393-63235415 TACCTCCATGTATGTTTTCCAGG + Intronic
1128678205 15:69627331-69627353 TTCATTCATTTATTTATTCTTGG - Intergenic
1129076557 15:73001984-73002006 TACCCAGATTATTTTATTCCAGG + Intergenic
1131541892 15:93281281-93281303 TGCCTTCATTTTTTTAATCCTGG - Intergenic
1133591056 16:7243973-7243995 AACATACATTTCTTTTTTCCTGG + Intronic
1133668916 16:7998462-7998484 TACCTGCATTTAATTAGCCCCGG + Intergenic
1135747230 16:25027522-25027544 TACCTACTTTAAATTATTTCAGG + Intergenic
1138170559 16:54845269-54845291 GACTTATCTTTATTTATTCCTGG - Intergenic
1138296704 16:55891989-55892011 TAGCTAGATTTTTTTCTTCCAGG + Intronic
1139128132 16:64106697-64106719 TACACACATTTATTGGTTCCAGG + Intergenic
1143128608 17:4661430-4661452 TCCCTACATGTATCTATTCATGG - Intergenic
1145283342 17:21484898-21484920 TATCTACTTTCATTTATTCTTGG - Intergenic
1145394143 17:22480932-22480954 TATCTACTTTCATTTATTCTTGG + Intergenic
1145822659 17:27851617-27851639 TATCTGCAATTATTTATCCCTGG - Intronic
1147783200 17:42958901-42958923 AACTTATATTTATTTATGCCAGG + Intronic
1148706708 17:49640418-49640440 TGCCTATAGGTATTTATTCCTGG - Intronic
1149477449 17:56975019-56975041 AAGCTACCTTTAATTATTCCTGG + Intergenic
1149826351 17:59832089-59832111 TATCTTCATATTTTTATTCCTGG - Intronic
1151737245 17:75951327-75951349 TACCAACATTTAGTTATCTCTGG + Intronic
1152050444 17:77970782-77970804 TACCTGCTTTTATCTATACCAGG - Intergenic
1156512066 18:37646037-37646059 GGCCTACATTTATTTTTACCTGG + Intergenic
1157538495 18:48480455-48480477 TAAATACATTAATTTATTTCTGG - Intergenic
1157642296 18:49229337-49229359 TGCAAACATTTATTTCTTCCAGG - Intronic
1158969534 18:62653790-62653812 AACCTCCATATATTGATTCCAGG + Intergenic
1159143328 18:64423446-64423468 TACATAAAGTTATATATTCCTGG - Intergenic
1159244357 18:65786038-65786060 CACTACCATTTATTTATTCCGGG - Intronic
1159278772 18:66256405-66256427 TAACTTCATCTATTTATTTCTGG - Intergenic
1160281040 18:77490965-77490987 TGACTACATTTATTCATTTCAGG - Intergenic
1164736756 19:30546725-30546747 TATCCACAATTATTTCTTCCAGG - Intronic
1165085116 19:33339685-33339707 TTGGTACATTTATTTCTTCCCGG - Intergenic
1165164752 19:33844196-33844218 TACCTACACATATATATTCTTGG - Intergenic
1165548000 19:36557920-36557942 TACCTACATTTACTTCTTTATGG - Intronic
926170468 2:10549981-10550003 TTGCTGCATTTAATTATTCCTGG - Intergenic
928523834 2:32118763-32118785 TTCTTACATTTATTTATTAAGGG + Intronic
929332922 2:40705881-40705903 TACTTAAGTTTATTTATTGCAGG + Intergenic
929992915 2:46804555-46804577 AACCCACATTTATTTACCCCAGG + Intergenic
931057704 2:58491317-58491339 TACCTCCATTTGTTTCCTCCAGG + Intergenic
931074562 2:58695237-58695259 TACTTATGTTTATTTATTTCAGG + Intergenic
934217215 2:90044027-90044049 TATTTATCTTTATTTATTCCAGG + Intergenic
935038782 2:99405296-99405318 TACCCACAATTAGTTACTCCTGG - Intronic
935752272 2:106246476-106246498 TAGATACATGTATTTATTTCTGG - Intergenic
935912683 2:107914019-107914041 TAGATACATGTATTTATTTCTGG - Intergenic
936865717 2:117074257-117074279 TTTTTACATTTATTGATTCCTGG - Intergenic
937759426 2:125582532-125582554 TAACTACATTTATTTCTTTGAGG + Intergenic
938914636 2:135924187-135924209 TAAGTACATTTTCTTATTCCAGG - Intronic
938927411 2:136056890-136056912 TACTAACATTTATTTAATCTGGG + Intergenic
938939370 2:136155603-136155625 TTCCAACCTTTATTTTTTCCTGG - Intergenic
939371343 2:141304912-141304934 TAAATACATTAATTTATTTCTGG + Intronic
939888701 2:147709909-147709931 CAGCTACATATATCTATTCCTGG - Intergenic
941276029 2:163491720-163491742 TGGCTACACTGATTTATTCCAGG - Intergenic
941485992 2:166083390-166083412 TATCTACATTTGTATACTCCAGG + Intronic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
943483384 2:188450439-188450461 TTCCTACATCTAATTACTCCAGG - Intronic
943829619 2:192443597-192443619 TACCCACATTTATGTATTTAAGG + Intergenic
943983484 2:194589049-194589071 TACCTACATATATGGATTCTAGG - Intergenic
944112021 2:196142706-196142728 TAATTACATTCATTTATTCTAGG + Intronic
944303215 2:198148857-198148879 TTTATACATTTATTTACTCCAGG + Intronic
944489647 2:200245031-200245053 TACCTACTATAATTTCTTCCAGG + Intergenic
945516347 2:210767486-210767508 TCCATTCATTTATTTATTCAAGG + Intergenic
945781259 2:214175183-214175205 TATATATATTTCTTTATTCCTGG - Intronic
947090276 2:226502520-226502542 TAAATACATTTATTTATTTCTGG - Intergenic
1168843793 20:927976-927998 TAGCTACATCTTTTTCTTCCAGG - Intergenic
1169648288 20:7839105-7839127 CTCATACATTTATTTATTCTGGG - Intergenic
1171792421 20:29539384-29539406 TTCCTCCATTTATTTTTTTCTGG + Intergenic
1172160682 20:32865975-32865997 TCCCTCCAGTTAATTATTCCTGG - Intronic
1172405923 20:34689106-34689128 GATTTACATTTATTTCTTCCAGG + Intergenic
1172945749 20:38687527-38687549 TACCCACATTTATGTTTTCTGGG - Intergenic
1173945199 20:46944773-46944795 ATGCTACATTTATTTTTTCCTGG + Intronic
1175356500 20:58373173-58373195 GATTTTCATTTATTTATTCCTGG - Intergenic
1176369888 21:6056301-6056323 TAAGTAAATTTATTTATTTCTGG - Intergenic
1176696767 21:9987170-9987192 ACCCTACATTTATTGATTCCTGG + Intergenic
1177052336 21:16252188-16252210 TATTTTCATTTATTTTTTCCTGG + Intergenic
1177283634 21:19019498-19019520 TATCTTCATTTTTATATTCCTGG - Intergenic
1179753631 21:43482240-43482262 TAAGTAAATTTATTTATTTCTGG + Intergenic
1180922694 22:19529621-19529643 TGCCTTCATTTATTTTTTTCAGG - Intergenic
1180936535 22:19629255-19629277 TACCTATATTTTTTAATCCCTGG + Intergenic
1184848583 22:47104335-47104357 TAGCTAGATTTTTTTCTTCCAGG + Intronic
949229371 3:1732388-1732410 AACATACACTTATTTATTCTCGG + Intergenic
949687929 3:6599396-6599418 TAGCAAAATATATTTATTCCTGG - Intergenic
949732119 3:7125621-7125643 CACTTACATTTATTTATCTCTGG + Intronic
951685763 3:25342570-25342592 AACCTTCTTTTTTTTATTCCTGG + Intronic
952424653 3:33163308-33163330 TACCGACATTAACTTATTGCTGG - Intronic
955046099 3:55361214-55361236 TATCTACATTTATTTTTTTCTGG - Intergenic
957794312 3:84983581-84983603 TACCTCCCTTTATTTCTGCCTGG + Intronic
957984903 3:87562047-87562069 TAACAACATTTATTTATTCATGG - Intergenic
958752509 3:98209180-98209202 TAGCTTCATTTATTTTTTCTAGG - Intergenic
959634012 3:108541919-108541941 TACCTATATTTATATATTGGTGG - Intergenic
959666582 3:108929213-108929235 TAACTCCACTTATTTATTGCTGG + Intronic
960807175 3:121595269-121595291 TAACTTCATTTAATTTTTCCAGG + Intronic
963598056 3:147353666-147353688 TATATATATTTATTTATTCATGG - Intergenic
964744936 3:160003412-160003434 TATTTAGATTTTTTTATTCCTGG - Intergenic
964845564 3:161040961-161040983 TACCTAGATCTGTTTCTTCCAGG + Intronic
966115931 3:176460636-176460658 TACCTACATTTCATGATTCTTGG + Intergenic
966481470 3:180413588-180413610 TCCCTGCATTTTTTTATGCCAGG - Intergenic
966569020 3:181419500-181419522 TTATTACATTTATTTATTCAAGG + Intergenic
970868907 4:20791515-20791537 TACTTCCATTTCTTTGTTCCTGG - Intronic
973024789 4:45254090-45254112 TAACTACATTTATTTTTTGCAGG + Intergenic
973088077 4:46093977-46093999 TATCTACATTAATTTAATCTGGG - Intronic
974935031 4:68401278-68401300 TAACTGCATATCTTTATTCCTGG - Intergenic
976384346 4:84438173-84438195 TACCTTCATTAATTTATTTTGGG - Intergenic
977035585 4:91948102-91948124 AACCTTTATGTATTTATTCCTGG - Intergenic
977152042 4:93524759-93524781 TACATACATATATTTTTTCTTGG - Intronic
977900156 4:102413214-102413236 TAATTATATTTATTTATTCCAGG - Intronic
978209537 4:106119343-106119365 TAAATACATTGATTTATTTCTGG - Intronic
979134485 4:117091988-117092010 TAATTATATTTATTTATTCAGGG - Intergenic
980369372 4:131847348-131847370 ACCCTACATTTATTGATTCCTGG + Intergenic
980387825 4:132109967-132109989 TACATATATTTATGTATTCATGG - Intergenic
981199546 4:141964536-141964558 TATTTATATTTATTTATTCATGG - Intergenic
981207481 4:142060499-142060521 TACATTCATTTCTTTATTCCTGG - Intronic
981465462 4:145065974-145065996 CACCTAGATTTTTTTTTTCCTGG - Intronic
981676819 4:147352076-147352098 TACCTACATTTCTTTCTTTGAGG + Intergenic
981707301 4:147674065-147674087 CCACTACATTTATATATTCCGGG + Intronic
982820355 4:159937222-159937244 TACCTATATTTATTATTTCAAGG + Intergenic
983480460 4:168267319-168267341 TAGCTAATTTTATTTATTCTCGG - Intronic
983740440 4:171124733-171124755 TAGCTCAATTTAATTATTCCAGG - Intergenic
984248486 4:177304049-177304071 AACCTACATTTTTTTGCTCCTGG - Intergenic
984377813 4:178954234-178954256 TACATACATATATTTATGCGTGG - Intergenic
984382532 4:179013721-179013743 TATCTTCATTTATTTACTTCTGG - Intergenic
986449856 5:7853054-7853076 TACCTACATCTTTTTCTTCTTGG + Intronic
988407423 5:30841460-30841482 CAGCTACATTCATTCATTCCAGG - Intergenic
988568070 5:32336473-32336495 TAGCTAGATTTTTTTCTTCCAGG - Intergenic
990200373 5:53366149-53366171 TTCCTACATTTATTTACTAAGGG + Intergenic
990423120 5:55657354-55657376 TACATACATATCTTTATTCCGGG - Intronic
993500015 5:88655285-88655307 TATCTACATTTATTTATACAAGG - Intergenic
993704299 5:91152265-91152287 TAAATACATTTAATCATTCCAGG + Intronic
993885071 5:93406590-93406612 TTCCTGCATTTATTTATTTAGGG + Intergenic
994842844 5:104948694-104948716 ACCCTACATTTATTGTTTCCTGG + Intergenic
994885154 5:105550782-105550804 TATCTGCATTTATTTATTAAGGG - Intergenic
995288259 5:110417108-110417130 TCCCTACATTTATTTATTATGGG - Intronic
995428813 5:112051657-112051679 TACCTCCATCTATTTATTTTGGG - Intergenic
995754190 5:115485249-115485271 TAAATACATTAATTTATTTCTGG + Intergenic
996311116 5:122107104-122107126 TATCTGTATTTATTTATTCCAGG + Intergenic
996720500 5:126625660-126625682 TTCCGACATTTATTTACTTCTGG - Exonic
996898163 5:128510972-128510994 TACCTCCATTTTTTTATTCATGG + Intronic
997091291 5:130861902-130861924 AAGCTACATTTAATTATTTCTGG + Intergenic
998734312 5:145118028-145118050 TACCTACTATTCTTTCTTCCAGG - Intergenic
999536612 5:152524260-152524282 TTCCTAAATTTATTTAGTTCTGG + Intergenic
1000115145 5:158147011-158147033 TACCTACATTCATCTACACCGGG + Intergenic
1000504103 5:162092688-162092710 TATATACATTTATTTATTCAAGG + Intronic
1003288817 6:4760413-4760435 CATCAACATTTATTTATTCTTGG - Intronic
1003462353 6:6341772-6341794 TGCCTTCATTTCTTTGTTCCTGG - Intergenic
1004472234 6:15939576-15939598 TCCATACATTTATTTAATCTAGG - Intergenic
1005737498 6:28762267-28762289 TACATATATTTCTTTTTTCCTGG + Intergenic
1006017101 6:31090585-31090607 TACATACAATGTTTTATTCCTGG - Intergenic
1006556409 6:34870973-34870995 TTCCTACATTTATTGCTTCATGG + Exonic
1007780203 6:44248227-44248249 TACCTACAGTTCTTTATTTGGGG - Intronic
1007952302 6:45883310-45883332 TTCCCAAATATATTTATTCCTGG + Intergenic
1008285333 6:49642413-49642435 TACATACATATATTTTTTCTCGG - Intergenic
1008794477 6:55285311-55285333 TACTTGAATTTATTTATTCTTGG + Intergenic
1008803032 6:55393214-55393236 TACCTAAATTTACTTTCTCCAGG - Intronic
1009357183 6:62765116-62765138 TAGCTAGATTTTTTTCTTCCAGG - Intergenic
1009445621 6:63738989-63739011 TCCATACATTTATTTATTAGTGG - Intronic
1010155766 6:72790716-72790738 TTCCTACATTTATTTATTTAGGG - Intronic
1010977629 6:82333877-82333899 TACCTACTTTATTTGATTCCTGG - Intergenic
1013375017 6:109506324-109506346 TACCTGCTTTTATTCTTTCCAGG + Exonic
1013941167 6:115664664-115664686 TTCCAAAAGTTATTTATTCCTGG + Intergenic
1014901416 6:126970080-126970102 TGCCTAAATTTACTTATTCATGG + Intergenic
1015352313 6:132235661-132235683 AACCTACATTTCTTTCTACCAGG + Intergenic
1016388961 6:143556253-143556275 TAAATTCATTTATTTATTTCAGG + Intronic
1016441475 6:144088856-144088878 TTCCTACATTTATTTAATCCTGG - Intergenic
1018164061 6:161077358-161077380 TACTAACATTTGTTTATTCTGGG + Intronic
1018594187 6:165460646-165460668 TAGCTACTTTTATATATTTCAGG - Intronic
1020486375 7:8725799-8725821 TACCTATTTTTTTTTATTTCTGG + Intronic
1020647813 7:10836706-10836728 TCCTTACATGTCTTTATTCCTGG - Intergenic
1020934254 7:14440474-14440496 TACATACCTTTATTTATTGAAGG - Intronic
1022430059 7:30310063-30310085 TAGCTACTGTTATTTTTTCCTGG - Intronic
1022899552 7:34791880-34791902 TACATACATGGATTTATTTCTGG - Intronic
1023121112 7:36909889-36909911 TTCATTCATTTATTTATTGCTGG - Intronic
1023304347 7:38808494-38808516 TACATACCTTTATTTATTCTAGG - Intronic
1023653743 7:42398389-42398411 TATCTACAAGTATTTATTGCAGG - Intergenic
1024384389 7:48735019-48735041 ACCCTACATTTAAGTATTCCAGG + Intergenic
1025041094 7:55646401-55646423 TATCTCCATTTCTTTATGCCTGG + Intergenic
1026063028 7:67043376-67043398 TAGCAACATTTATTTACTGCAGG - Intronic
1027145269 7:75689500-75689522 TACCTTTATTTATTTATTTGAGG - Intronic
1027729636 7:81854364-81854386 GACATGCATTTATTTATTCTGGG - Intergenic
1028193970 7:87883586-87883608 TACCTACATTTATTTATTCCAGG - Intronic
1028267476 7:88744112-88744134 TATCTACATTTATTTAGTTTTGG + Intergenic
1028334410 7:89633789-89633811 TAAGTACATGTATTTATTTCTGG + Intergenic
1030474254 7:110008805-110008827 TACCTACATTGACTTTTTTCAGG + Intergenic
1030498194 7:110326449-110326471 TCCCAACATTTATTTTTTTCTGG - Intergenic
1031814515 7:126416696-126416718 TTCCTCCATTTATTTATTATTGG - Intergenic
1032774772 7:135100618-135100640 TACCTAAATTTCTATATTTCTGG - Intronic
1034833347 7:154329018-154329040 TTATTACATTTTTTTATTCCTGG + Intronic
1036188575 8:6648296-6648318 TACCCACTTTTATTTTTCCCAGG + Intergenic
1036543495 8:9742841-9742863 TACATACATTTATATATTTAAGG + Intronic
1036598997 8:10241647-10241669 TGCCTAGATGTATTAATTCCTGG - Intronic
1036744147 8:11392016-11392038 AACCCACATTTAGTTATTCAGGG - Intronic
1037216085 8:16453150-16453172 TACATAATTTTATTTCTTCCTGG + Intronic
1037622896 8:20582142-20582164 TACAGACATTTATTTTTGCCTGG - Intergenic
1037730755 8:21521622-21521644 TACCTACCTTTTTTGATTCTTGG - Intergenic
1038371260 8:26994013-26994035 AACCTACATTTATTTAATATAGG + Intergenic
1038739087 8:30200812-30200834 TAGCTAGATTTTTTTCTTCCAGG + Intergenic
1039070744 8:33647306-33647328 GACCTATGTTCATTTATTCCAGG - Intergenic
1039367549 8:36946544-36946566 TAAATACATGTATTTATTTCTGG - Intergenic
1040658178 8:49537229-49537251 TAACTACAGTTATTTCTTCCTGG - Exonic
1041014620 8:53579844-53579866 TACATACTTTTATTTATTTATGG + Intergenic
1041628883 8:60062432-60062454 TTCAATCATTTATTTATTCCAGG + Intergenic
1042065063 8:64865362-64865384 TCCCTTCATTTATTCATTCATGG - Intergenic
1043086109 8:75835539-75835561 TCCCTACATAGATTTATTCCAGG + Intergenic
1043090570 8:75896862-75896884 TTGCCACCTTTATTTATTCCTGG - Intergenic
1043302819 8:78755139-78755161 TAAATACATTGATTTATTTCTGG + Intronic
1044236585 8:89838369-89838391 AACCTATATGTATTTAGTCCTGG + Intergenic
1046360400 8:113146221-113146243 TACACTCATTTTTTTATTCCTGG - Intronic
1046977279 8:120294904-120294926 GAGCTCAATTTATTTATTCCGGG - Intronic
1047860071 8:128956337-128956359 TACCTACATTTGTTTAGTAATGG - Intergenic
1052190146 9:25651652-25651674 TACCTTCATTCAATTATTTCTGG + Intergenic
1052360450 9:27550881-27550903 TACATTCATTTATTTACTCAAGG + Intronic
1052438279 9:28459045-28459067 TACATACATTCATTGATGCCAGG - Intronic
1052786662 9:32834512-32834534 TAATTATATTCATTTATTCCAGG - Intergenic
1053633744 9:39973016-39973038 ACCCTACATTTATTGATTCCTGG + Intergenic
1053772006 9:41490484-41490506 ACCCTACATTTATTGATTCCTGG - Intergenic
1054210143 9:62277681-62277703 ACCCTACATTTATTGATTCCTGG - Intergenic
1054314850 9:63571247-63571269 ACCCTACATTTATTGATTCCTGG + Intergenic
1055039709 9:71856239-71856261 TATCTAAATTCATTGATTCCTGG + Intergenic
1058277404 9:103061526-103061548 TACATCCATTTATTAGTTCCAGG - Intergenic
1059220419 9:112611493-112611515 TTGTTAAATTTATTTATTCCTGG - Intronic
1059789691 9:117627398-117627420 TGCCTAAATTAAGTTATTCCTGG - Intergenic
1186144569 X:6611865-6611887 TCCCAACATTTAATTGTTCCCGG + Intergenic
1187034278 X:15521606-15521628 TACTTACATTTATTGGTTCCTGG + Intronic
1187140677 X:16590532-16590554 TACTTATATTTTTTTTTTCCTGG + Intronic
1187222401 X:17340905-17340927 TACATATATATACTTATTCCTGG - Intergenic
1189141331 X:38609888-38609910 TAGCGACATTTCTTTATTGCTGG - Intronic
1190479141 X:50858123-50858145 TACCTAAACTTATTTATCCCAGG - Intergenic
1191934546 X:66412274-66412296 TAACCACTTTTATTGATTCCTGG + Intergenic
1194211682 X:91077648-91077670 TAACTTCATTGATTTATTGCAGG + Intergenic
1194350015 X:92815306-92815328 TACATACATGTGATTATTCCTGG - Intergenic
1194671523 X:96739639-96739661 TACCAACAAATATTTATTCAAGG - Intronic
1194800872 X:98270732-98270754 TAAATACATAGATTTATTCCTGG - Intergenic
1196301872 X:114057434-114057456 TAGCTAGATCTTTTTATTCCAGG + Intergenic
1196559832 X:117132372-117132394 TATATACATTTATATATTTCTGG - Intergenic
1196588328 X:117456734-117456756 CACCTACATTTCTTTATTCATGG + Intergenic
1196999957 X:121428261-121428283 TCTCTACATTTATTTTTTCCTGG + Intergenic
1197339913 X:125254967-125254989 TAAGAACATTTACTTATTCCAGG + Intergenic
1198009056 X:132531748-132531770 TACCTTCATTTTTTTATTAGGGG + Intergenic
1198752280 X:139948037-139948059 TACCTACATATATTGATTGATGG + Intergenic
1198833381 X:140775721-140775743 TACATACATTTCCTCATTCCAGG - Intergenic
1198854475 X:141002191-141002213 TGGCTACATTTATTTATTGGCGG - Intergenic
1198908225 X:141585158-141585180 TGGCTACATTTATTTATTGGCGG + Intronic
1198908566 X:141589266-141589288 TGGCTACATTTATTTATTGGCGG - Intronic
1198918504 X:141698886-141698908 TGGCTACATTTATTTATTGGCGG + Intergenic
1200658334 Y:5931921-5931943 TACATACATGTGATTATTCCTGG - Intergenic
1200956346 Y:8950479-8950501 TACCTACAACTATTTATTTATGG + Intergenic
1202200976 Y:22347498-22347520 TACCTACAACTATTTATTTATGG + Intronic