ID: 1028196138

View in Genome Browser
Species Human (GRCh38)
Location 7:87910342-87910364
Sequence CCAGCCAGTGAGATGAAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028196132_1028196138 22 Left 1028196132 7:87910297-87910319 CCACATACAGTTTGGATTGTGCT No data
Right 1028196138 7:87910342-87910364 CCAGCCAGTGAGATGAAGGCAGG No data
1028196131_1028196138 25 Left 1028196131 7:87910294-87910316 CCACCACATACAGTTTGGATTGT No data
Right 1028196138 7:87910342-87910364 CCAGCCAGTGAGATGAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028196138 Original CRISPR CCAGCCAGTGAGATGAAGGC AGG Intergenic
No off target data available for this crispr