ID: 1028196395

View in Genome Browser
Species Human (GRCh38)
Location 7:87912516-87912538
Sequence TGAGATGATGATGTATGAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028196395_1028196396 30 Left 1028196395 7:87912516-87912538 CCATCTCATACATCATCATCTCA No data
Right 1028196396 7:87912569-87912591 TGTGTGACTCTCCATTAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028196395 Original CRISPR TGAGATGATGATGTATGAGA TGG (reversed) Intergenic