ID: 1028197129

View in Genome Browser
Species Human (GRCh38)
Location 7:87920236-87920258
Sequence TGCCATGGCCACTGTGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1028197129_1028197133 -9 Left 1028197129 7:87920236-87920258 CCATCCCCACAGTGGCCATGGCA No data
Right 1028197133 7:87920250-87920272 GCCATGGCAAGCACCACCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028197129 Original CRISPR TGCCATGGCCACTGTGGGGA TGG (reversed) Intergenic
No off target data available for this crispr