ID: 1028201553

View in Genome Browser
Species Human (GRCh38)
Location 7:87967865-87967887
Sequence CAAGGTGCTTACAGAGATAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 143}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1028201553 Original CRISPR CAAGGTGCTTACAGAGATAT TGG Intronic
904270299 1:29345341-29345363 GAAGAGGCTTACAGAGAAATGGG + Intergenic
905517968 1:38576237-38576259 CCTGGTGCATACAGAAATATGGG - Intergenic
909209674 1:72807819-72807841 CAAGGTGATTAAAGAGCTTTTGG - Intergenic
910282979 1:85521850-85521872 TAAGGAGCTTACAAAGAAATGGG - Intronic
911768741 1:101712210-101712232 CAAGGTACTTAGAGACATAATGG - Intergenic
913228017 1:116717567-116717589 CAAGGAGTTTACAGACATTTAGG - Intergenic
914207035 1:145541143-145541165 TAAGGAGCTTACAAAGAAATGGG + Intergenic
915512209 1:156392572-156392594 GAAGGTCCTTACAGAGCGATGGG - Intergenic
922987288 1:229875548-229875570 CAAGATGTTTAAAGAGTTATTGG + Intergenic
923989838 1:239424150-239424172 CAATGTGCTTCCATAGATTTCGG + Intronic
1064548327 10:16473727-16473749 GAAGCTGCTGAAAGAGATATTGG + Intronic
1064670739 10:17711447-17711469 CAAGGTGCTTACTGAGTAGTAGG + Intronic
1068210844 10:53918221-53918243 CAAGGTTTTTAAAGAAATATTGG - Intronic
1071759199 10:88581947-88581969 AAATATGCTTACAGAGAAATAGG - Intronic
1071769365 10:88707963-88707985 CTGGGTGTTTACAGAGATTTAGG - Intergenic
1072159632 10:92754123-92754145 CATGGTTCTTACATAGAGATAGG - Intergenic
1073640775 10:105250515-105250537 CAAGGCCCTTACAGAGACCTTGG - Intronic
1074764438 10:116690342-116690364 CACGGTCCTGACAGAGAGATAGG + Intronic
1079155041 11:17938363-17938385 TTAGGTGCTTGCAGGGATATAGG - Intronic
1081477135 11:43445425-43445447 CTGGGTGCTAACAGAGCTATAGG + Intronic
1082066795 11:47907539-47907561 CAAGGTGCTTACACAACTTTGGG + Intergenic
1086456065 11:86959775-86959797 CAAGGAGCTTACAGTCACATTGG + Intergenic
1087620990 11:100541410-100541432 CAAGGTGCTGACAGACTTTTGGG - Intergenic
1088202368 11:107352342-107352364 CAAGTTGCTTACAGCTTTATGGG - Intronic
1088557955 11:111082142-111082164 CAAAGTGCTTTCAAAAATATTGG + Intergenic
1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG + Intronic
1090600528 11:128365280-128365302 CAGGGTGCTTAGAAACATATGGG - Intergenic
1094428042 12:30336450-30336472 AAAGCTACTTTCAGAGATATAGG + Intergenic
1098741663 12:74179832-74179854 CAAAATGCTTACAGTGATACGGG - Intergenic
1101900987 12:108790965-108790987 CCTGGTGCTTACTGAGAAATTGG - Intronic
1103043740 12:117717984-117718006 CTAGGTGCTTACACAAATGTTGG - Intronic
1106185421 13:27405432-27405454 CCAGGTGCTTCCACAGATTTGGG - Intergenic
1108845531 13:54675249-54675271 ATTGTTGCTTACAGAGATATTGG - Intergenic
1111221242 13:85207840-85207862 CAAAGTGCTGATAGTGATATGGG + Intergenic
1113125277 13:106971451-106971473 GAAGGTGCAGACAGAGATACAGG + Intergenic
1113816301 13:113173639-113173661 CAAGGACCTTTCAGAGAAATGGG - Intergenic
1114058166 14:18993395-18993417 CAAGCTGCTCACATTGATATTGG + Intronic
1114104381 14:19408359-19408381 CAAGCTGCTCACATTGATATTGG - Intronic
1116868571 14:50050937-50050959 CAAGGTGCTTCAGGAGATACGGG + Intergenic
1123497288 15:20840946-20840968 CAAGCTGCTCACATTGATATTGG - Intronic
1123590767 15:21851899-21851921 CAAGCTGCTCACATTGATATTGG - Intergenic
1124127794 15:26953421-26953443 CAAGGAGCTGAGAGGGATATAGG - Intergenic
1124388022 15:29225862-29225884 CCAGGTGCTCAGAGAGGTATTGG + Intronic
1130186589 15:81689318-81689340 CAAAATGCTTCAAGAGATATGGG - Intergenic
1130200177 15:81818648-81818670 CAATGTGATAACAGATATATAGG + Intergenic
1130762233 15:86832664-86832686 CAAAATGCTGACAGTGATATGGG - Intronic
1202962868 15_KI270727v1_random:141778-141800 CAAGCTGCTCACATTGATATTGG - Intergenic
1143225697 17:5300831-5300853 GAAGTTGCTTACAGAGTCATTGG + Intronic
1143920073 17:10324165-10324187 CAAGGAGCTGACGGAGAGATTGG - Exonic
1146213361 17:30959022-30959044 CAAGGTGCTTCCAGAGCCAGAGG - Exonic
1148055773 17:44794523-44794545 CAACGTGCTTTCAGAAAAATGGG + Intergenic
1148221738 17:45867627-45867649 CAAGGTGCATACACGGAAATTGG - Intergenic
1149190819 17:54059227-54059249 GGGGGTGCTTACAGAGACATGGG + Intergenic
1151368430 17:73631710-73631732 CAAGGTGCTTGCAGCTGTATGGG + Intronic
1153363381 18:4224736-4224758 CCAGGTGGGTCCAGAGATATGGG - Intronic
1153949826 18:10048749-10048771 CATGGTGATTACAGTGATGTGGG + Intergenic
1154455310 18:14517354-14517376 CAAGCTGCTCACATTGATATTGG - Intronic
1158924883 18:62245653-62245675 CAAGGTTGCTACACAGATATAGG + Intronic
1166349829 19:42191309-42191331 CAAGGTGCTGACACAGAGCTGGG - Intronic
929612688 2:43283485-43283507 CAAAATGCTGACAGTGATATGGG + Intronic
929750760 2:44710913-44710935 TAAGATGCTTACAGAGAAATGGG - Intronic
938283045 2:130080844-130080866 CAAGCTGCTCACACTGATATTGG - Intronic
938356141 2:130651273-130651295 CAAGCTGCTCACACTGATATTGG + Intronic
938432565 2:131258055-131258077 CAAGCTGCTCACACTGATATTGG + Intronic
938476575 2:131620335-131620357 CAAGCTGCTCACATTGATATTGG + Intergenic
939420035 2:141955402-141955424 CAAGATGCTTCCAGATTTATGGG + Intronic
939994846 2:148910532-148910554 CATGGTGCTTCCAGAGGAATGGG + Intronic
942025670 2:171908228-171908250 CAAGGTGCTTACAGAAATGAGGG + Intronic
942238554 2:173937052-173937074 CAAGAAGCTTACAGATTTATTGG - Intronic
942850021 2:180473282-180473304 CAAGGTGCCAACAGAGATCATGG - Intergenic
945589088 2:211706508-211706530 CAAGGTGGTTCCAGAGATCAAGG - Intronic
945617559 2:212091609-212091631 CAAAGGGCTTAAAGAAATATTGG + Intronic
1170906383 20:20518524-20518546 CAAGATGCTTAAAAACATATTGG - Intronic
1172748155 20:37229384-37229406 CAAGGTGCTTTCAGTGCAATGGG + Intronic
1175597083 20:60243852-60243874 CAAGGTGCTTATAGACAACTGGG + Intergenic
1176818859 21:13635958-13635980 CAAGCTGCTCACATTGATATTGG + Intronic
1176995261 21:15548135-15548157 CAAGGTGACTACAGGGAAATAGG + Intergenic
1177020461 21:15849625-15849647 AAAGGTGCTTACATGCATATTGG + Intronic
1177298048 21:19202507-19202529 CAAGGTGAGTACAGAGCAATTGG - Intergenic
1180476653 22:15716011-15716033 CAAGCTGCTCACATTGATATTGG + Intronic
1180685776 22:17665327-17665349 CAAAATGCTGACAGTGATATGGG - Intronic
1182039332 22:27224312-27224334 CAAGGAACATACAGAGACATTGG + Intergenic
956342356 3:68239813-68239835 CAAGGTTGTTACAGGGACATGGG - Intronic
958428018 3:94002027-94002049 TAAGGTGCTTACCAAGAGATTGG + Intronic
958685574 3:97388408-97388430 AAAGGTGTTCACAGAGAAATGGG + Intronic
960029500 3:113043054-113043076 GAAGCTGCTTACAGAGATATAGG + Intergenic
963961923 3:151318954-151318976 CACGTTGCTTACAGAGGTATTGG - Intronic
964872612 3:161329772-161329794 CAAGGTGCATGCAGTGATAGGGG - Intergenic
966294419 3:178402314-178402336 CTAGGTGCTCACAGAGAGACTGG - Intergenic
974082549 4:57227729-57227751 GAAGGTGATTAAAGTGATATTGG + Intergenic
974570834 4:63646715-63646737 AAATATGCTTAGAGAGATATAGG - Intergenic
974994315 4:69134407-69134429 CCTGGTGGTTACAGAGATTTTGG - Intronic
977151958 4:93523669-93523691 CCAGGTGCTTACTGAGGTGTGGG + Intronic
982463404 4:155700129-155700151 GAAGGAGCTTACAGAATTATTGG - Intronic
982669505 4:158303337-158303359 GGAGGTGCTAACAGAGATAATGG - Intergenic
983138793 4:164122350-164122372 CAAGCTGCAGACATAGATATTGG + Intronic
986785395 5:11109940-11109962 ACAGGTGCGTACATAGATATAGG - Intronic
987198373 5:15549976-15549998 CAAGGTACCTGCAGAGATTTGGG + Intronic
993359032 5:86950253-86950275 CAAGGGGATTACTGAGATCTAGG - Intergenic
995109571 5:108413817-108413839 CAAGGAGCAAACAAAGATATAGG + Intergenic
996483324 5:124000456-124000478 TAATGTGCTTACAGAATTATAGG - Intergenic
996652117 5:125891166-125891188 CAAGCAGCCTACAGGGATATTGG + Intergenic
997284112 5:132666020-132666042 CAAGGTGCCTGCAGAGATGCTGG + Intergenic
997351449 5:133234184-133234206 CAGGCTGCTTGCAGAGATCTTGG + Intronic
998730605 5:145071471-145071493 CAAAGTGGGTACAGAGATAGAGG + Intergenic
999352996 5:150894854-150894876 CAAGGTCCTTCCAGAGATGCAGG + Exonic
1001347429 5:170918046-170918068 CAAGGAGCTTACAGACAACTGGG + Intronic
1001474141 5:172037570-172037592 CAGGGTGCTTACAGTAATCTAGG - Intergenic
1003615250 6:7649207-7649229 CACGGTGCTAACAGAGCTAGAGG - Intergenic
1005475327 6:26202383-26202405 GAAGGTAATTACAGAGATACTGG - Intergenic
1009157704 6:60243372-60243394 GAAAGAGCTTACAGAGACATGGG - Intergenic
1009677775 6:66848447-66848469 AAAGGTGTTTACAGGGAGATTGG + Intergenic
1009684918 6:66944634-66944656 CAAAGTTCTTACATAGATAAAGG + Intergenic
1009708104 6:67281527-67281549 CAACCTGCATACAGAGATAATGG + Intergenic
1012588963 6:100955639-100955661 CAAGTTGCTTGGTGAGATATTGG + Intergenic
1013015926 6:106160568-106160590 CAAGGTGCTTAGAAAGAGGTGGG + Intergenic
1014866438 6:126536520-126536542 CGGGGTGCTGAGAGAGATATTGG - Intergenic
1016294560 6:142561135-142561157 CAAGCTGCTCTCAGAGACATGGG + Intergenic
1018754031 6:166832943-166832965 CAAGCTGCTTTCAAACATATTGG - Intronic
1022493579 7:30838931-30838953 TAAGGAGCTTACAAAGATTTTGG + Intronic
1023293059 7:38687330-38687352 CAAGGGGCTAACAGAGGTAGGGG + Intergenic
1026322665 7:69281204-69281226 CAAGGAGCTTACTGAGTTAGTGG - Intergenic
1026390776 7:69899441-69899463 CAAGGTGCTGGCAGAGATTGCGG - Exonic
1028201553 7:87967865-87967887 CAAGGTGCTTACAGAGATATTGG + Intronic
1028693152 7:93676745-93676767 GATGGCGCTTACAGAGATTTTGG - Intronic
1031321362 7:120333279-120333301 CAAAGGGCTTACAAATATATGGG + Intronic
1031717850 7:125130740-125130762 CAAGGTGATGGCAGAGATAATGG + Intergenic
1034049306 7:147965282-147965304 CAAATTGATTACAGACATATGGG + Intronic
1036461652 8:8958856-8958878 CAAGCTGCTTCCTGAGATAGGGG + Intergenic
1040085498 8:43336014-43336036 CAAGCTGCTCACATTGATATTGG + Intergenic
1041263307 8:56040330-56040352 CAAGGTCCTTATAGAGAAAAGGG + Intergenic
1041371767 8:57168856-57168878 CAGGGTGGTTACACAAATATTGG - Intergenic
1046316016 8:112502472-112502494 CCAAGTGATGACAGAGATATCGG + Intronic
1046668917 8:117036246-117036268 CAAAATGCTGACAGTGATATGGG - Intronic
1046720054 8:117609048-117609070 CAAAGAGCTTACAGACAAATTGG - Intergenic
1047413238 8:124641278-124641300 CAAGTTGCTCACAGGTATATGGG - Intronic
1048531339 8:135253180-135253202 AAAGGTTCTTACAGAGATGAAGG + Intergenic
1051721101 9:20038385-20038407 CAAGGTCCTTACTGGGGTATTGG - Intergenic
1052530356 9:29675251-29675273 CAAAGTGCTGACAAAGATTTTGG + Intergenic
1054739003 9:68785788-68785810 CAATGTGCTTACAAAGATGCTGG + Intronic
1055183038 9:73413184-73413206 AAAGTTGCTTACAGAGTTTTGGG - Intergenic
1058026805 9:100149576-100149598 GAAGGTGCTTTCAGATATTTAGG + Intronic
1059897323 9:118881131-118881153 CATGGTGCTTAAAAACATATTGG + Intergenic
1203528498 Un_GL000213v1:113547-113569 CAAGCTGCTCACATTGATATTGG - Intergenic
1186315112 X:8361076-8361098 GAAGGTGTTTACACAGACATAGG + Intergenic
1190300956 X:49057333-49057355 AAAGGTGGTTACAGAGACAATGG - Intronic
1195432851 X:104808730-104808752 AAAGATGATTCCAGAGATATTGG + Intronic
1197695330 X:129543553-129543575 TAAGGTGATTACAGGAATATGGG - Intronic
1199659420 X:150033277-150033299 AAAAGTGCTTACTGAGATATTGG + Intergenic